\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142954896:

Variant ID: vg0142954896 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 42954896
Reference Allele: TAlternative Allele: A,G
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCTTATTTAAAAAATTTAAGTAATTATTAATTCTTTTCCTATCATTTGATTCATTGTTAAATATACTACTACTCAAGTTTTTGAATAATATTCACAAAA[T/A,G]
TTTTTAAATAAGACAAATGGTCAAACATGTTTAAAAAAGTCAACGGCATCAAATATTTAGGGACGGAGCGAATGATTCAATAGTAATTCTTGCCATCACT

Reverse complement sequence

AGTGATGGCAAGAATTACTATTGAATCATTCGCTCCGTCCCTAAATATTTGATGCCGTTGACTTTTTTAAACATGTTTGACCATTTGTCTTATTTAAAAA[A/T,C]
TTTTGTGAATATTATTCAAAAACTTGAGTAGTAGTATATTTAACAATGAATCAAATGATAGGAAAAGAATTAATAATTACTTAAATTTTTTAAATAAGAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.60% 37.50% 4.08% 0.83% G: 0.06%
All Indica  2759 78.20% 18.10% 2.25% 1.38% G: 0.04%
All Japonica  1512 32.70% 59.20% 8.07% 0.07% NA
Aus  269 11.20% 88.10% 0.74% 0.00% NA
Indica I  595 98.70% 1.30% 0.00% 0.00% NA
Indica II  465 87.70% 9.20% 1.72% 1.29% NA
Indica III  913 62.70% 30.70% 4.05% 2.63% NA
Indica Intermediate  786 75.20% 21.50% 2.16% 1.02% G: 0.13%
Temperate Japonica  767 59.80% 27.80% 12.39% 0.00% NA
Tropical Japonica  504 1.40% 96.20% 2.18% 0.20% NA
Japonica Intermediate  241 11.60% 81.70% 6.64% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 40.00% 50.00% 7.78% 0.00% G: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142954896 T -> G LOC_Os01g74146.1 downstream_gene_variant ; 2182.0bp to feature; MODIFIER silent_mutation Average:41.138; most accessible tissue: Zhenshan97 flower, score: 80.311 N N N N
vg0142954896 T -> G LOC_Os01g74152.1 intron_variant ; MODIFIER silent_mutation Average:41.138; most accessible tissue: Zhenshan97 flower, score: 80.311 N N N N
vg0142954896 T -> A LOC_Os01g74146.1 downstream_gene_variant ; 2182.0bp to feature; MODIFIER silent_mutation Average:41.138; most accessible tissue: Zhenshan97 flower, score: 80.311 N N N N
vg0142954896 T -> A LOC_Os01g74152.1 intron_variant ; MODIFIER silent_mutation Average:41.138; most accessible tissue: Zhenshan97 flower, score: 80.311 N N N N
vg0142954896 T -> DEL N N silent_mutation Average:41.138; most accessible tissue: Zhenshan97 flower, score: 80.311 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142954896 NA 3.86E-12 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0142954896 NA 1.21E-08 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896 NA 4.10E-10 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896 NA 5.59E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896 NA 2.45E-08 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896 NA 6.81E-08 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896 NA 1.83E-08 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896 NA 9.18E-07 mr1902 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896 NA 5.18E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896 NA 8.59E-06 mr1060_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896 NA 3.40E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896 NA 1.32E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896 NA 4.22E-21 mr1164_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896 NA 9.52E-09 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896 NA 4.31E-09 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896 NA 1.45E-08 mr1319_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896 NA 2.52E-13 mr1330_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896 NA 7.97E-12 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896 NA 4.55E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896 NA 1.03E-13 mr1454_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896 NA 7.79E-16 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896 NA 6.13E-07 mr1548_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896 NA 3.18E-38 mr1580_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896 NA 5.95E-10 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896 NA 4.32E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896 NA 2.13E-20 mr1627_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896 NA 3.74E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896 NA 6.01E-08 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896 NA 1.51E-10 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896 NA 1.25E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896 NA 7.12E-37 mr1825_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251