Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0142910448:

Variant ID: vg0142910448 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 42910448
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTGAATTTAAACTTGCATGTTTGTGAAACGATATATTTCATATTAGTCTATATTGCCATTTATTTTATATTTTCTTATGACTATTTAGGTGGCATGCAC[G/A]
AAACGAGAGGATATCCCATTGAGGATGAAATCACTTTCCCAAAAGTTTTATAACTGAAACAAGTATTGATTGATATAATATATAATCCAGTGACGTGTGT

Reverse complement sequence

ACACACGTCACTGGATTATATATTATATCAATCAATACTTGTTTCAGTTATAAAACTTTTGGGAAAGTGATTTCATCCTCAATGGGATATCCTCTCGTTT[C/T]
GTGCATGCCACCTAAATAGTCATAAGAAAATATAAAATAAATGGCAATATAGACTAATATGAAATATATCGTTTCACAAACATGCAAGTTTAAATTCAAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.70% 9.60% 0.68% 1.93% NA
All Indica  2759 86.40% 12.50% 1.01% 0.07% NA
All Japonica  1512 94.10% 0.00% 0.00% 5.89% NA
Aus  269 58.70% 40.10% 1.12% 0.00% NA
Indica I  595 75.50% 24.00% 0.34% 0.17% NA
Indica II  465 98.90% 0.90% 0.22% 0.00% NA
Indica III  913 84.60% 13.40% 1.97% 0.11% NA
Indica Intermediate  786 89.60% 9.50% 0.89% 0.00% NA
Temperate Japonica  767 97.50% 0.00% 0.00% 2.48% NA
Tropical Japonica  504 93.10% 0.00% 0.00% 6.94% NA
Japonica Intermediate  241 85.50% 0.00% 0.00% 14.52% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 4.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142910448 G -> A LOC_Os01g74110.1 upstream_gene_variant ; 2974.0bp to feature; MODIFIER silent_mutation Average:28.204; most accessible tissue: Zhenshan97 root, score: 85.677 N N N N
vg0142910448 G -> A LOC_Os01g74110-LOC_Os01g74120 intergenic_region ; MODIFIER silent_mutation Average:28.204; most accessible tissue: Zhenshan97 root, score: 85.677 N N N N
vg0142910448 G -> DEL N N silent_mutation Average:28.204; most accessible tissue: Zhenshan97 root, score: 85.677 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0142910448 G A -0.06 -0.03 -0.02 -0.03 -0.04 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142910448 NA 4.60E-06 mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142910448 NA 5.52E-07 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142910448 1.22E-06 NA mr1249 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142910448 2.67E-06 2.67E-06 mr1249 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142910448 NA 2.79E-06 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142910448 NA 1.89E-06 mr1692 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142910448 NA 8.39E-06 mr1735 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142910448 NA 4.87E-08 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142910448 NA 1.71E-08 mr1839 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142910448 NA 7.09E-06 mr1959 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142910448 3.66E-07 3.66E-07 mr1985 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142910448 NA 3.99E-06 mr1015_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142910448 NA 8.74E-06 mr1031_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142910448 NA 8.01E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142910448 NA 9.23E-06 mr1336_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142910448 NA 2.96E-06 mr1494_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142910448 NA 4.34E-06 mr1579_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142910448 NA 5.09E-06 mr1683_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142910448 NA 1.83E-06 mr1759_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142910448 NA 9.31E-06 mr1814_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251