\
| Variant ID: vg0142903537 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 42903537 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATAATAACTCTCTCATACTATATTTACTCTAGCAACAAACTCGATGCATGCACCATCCCCAATATTTCCTAGCCAATAGCAAATCAAGATATTGCATGTG[G/A]
GTTATAAATACTTGTGTGCATGGATACATGCATCAATGTCTATTTACTCCAATACACAAATAACGAATAGACTTAATAAATGAACACAAATATGTAGATC
GATCTACATATTTGTGTTCATTTATTAAGTCTATTCGTTATTTGTGTATTGGAGTAAATAGACATTGATGCATGTATCCATGCACACAAGTATTTATAAC[C/T]
CACATGCAATATCTTGATTTGCTATTGGCTAGGAAATATTGGGGATGGTGCATGCATCGAGTTTGTTGCTAGAGTAAATATAGTATGAGAGAGTTATTAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.30% | 10.70% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 86.00% | 14.00% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 58.00% | 42.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 76.10% | 23.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 83.60% | 16.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 88.50% | 11.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0142903537 | G -> A | LOC_Os01g74090.1 | upstream_gene_variant ; 1518.0bp to feature; MODIFIER | silent_mutation | Average:46.952; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg0142903537 | G -> A | LOC_Os01g74100.1 | upstream_gene_variant ; 848.0bp to feature; MODIFIER | silent_mutation | Average:46.952; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg0142903537 | G -> A | LOC_Os01g74080.1 | downstream_gene_variant ; 3614.0bp to feature; MODIFIER | silent_mutation | Average:46.952; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg0142903537 | G -> A | LOC_Os01g74110.1 | downstream_gene_variant ; 2029.0bp to feature; MODIFIER | silent_mutation | Average:46.952; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg0142903537 | G -> A | LOC_Os01g74090-LOC_Os01g74100 | intergenic_region ; MODIFIER | silent_mutation | Average:46.952; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0142903537 | NA | 6.92E-06 | mr1641 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142903537 | NA | 8.96E-08 | mr1739 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142903537 | NA | 4.34E-06 | mr1839 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142903537 | NA | 6.72E-06 | mr1959 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142903537 | NA | 7.62E-06 | mr1013_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142903537 | 3.79E-06 | 3.79E-06 | mr1049_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142903537 | NA | 1.85E-06 | mr1543_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142903537 | 4.21E-06 | 7.74E-09 | mr1904_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |