\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142903537:

Variant ID: vg0142903537 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 42903537
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAATAACTCTCTCATACTATATTTACTCTAGCAACAAACTCGATGCATGCACCATCCCCAATATTTCCTAGCCAATAGCAAATCAAGATATTGCATGTG[G/A]
GTTATAAATACTTGTGTGCATGGATACATGCATCAATGTCTATTTACTCCAATACACAAATAACGAATAGACTTAATAAATGAACACAAATATGTAGATC

Reverse complement sequence

GATCTACATATTTGTGTTCATTTATTAAGTCTATTCGTTATTTGTGTATTGGAGTAAATAGACATTGATGCATGTATCCATGCACACAAGTATTTATAAC[C/T]
CACATGCAATATCTTGATTTGCTATTGGCTAGGAAATATTGGGGATGGTGCATGCATCGAGTTTGTTGCTAGAGTAAATATAGTATGAGAGAGTTATTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.30% 10.70% 0.02% 0.00% NA
All Indica  2759 86.00% 14.00% 0.04% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 58.00% 42.00% 0.00% 0.00% NA
Indica I  595 76.10% 23.90% 0.00% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 83.60% 16.40% 0.00% 0.00% NA
Indica Intermediate  786 88.50% 11.30% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142903537 G -> A LOC_Os01g74090.1 upstream_gene_variant ; 1518.0bp to feature; MODIFIER silent_mutation Average:46.952; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0142903537 G -> A LOC_Os01g74100.1 upstream_gene_variant ; 848.0bp to feature; MODIFIER silent_mutation Average:46.952; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0142903537 G -> A LOC_Os01g74080.1 downstream_gene_variant ; 3614.0bp to feature; MODIFIER silent_mutation Average:46.952; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0142903537 G -> A LOC_Os01g74110.1 downstream_gene_variant ; 2029.0bp to feature; MODIFIER silent_mutation Average:46.952; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0142903537 G -> A LOC_Os01g74090-LOC_Os01g74100 intergenic_region ; MODIFIER silent_mutation Average:46.952; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142903537 NA 6.92E-06 mr1641 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142903537 NA 8.96E-08 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142903537 NA 4.34E-06 mr1839 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142903537 NA 6.72E-06 mr1959 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142903537 NA 7.62E-06 mr1013_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142903537 3.79E-06 3.79E-06 mr1049_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142903537 NA 1.85E-06 mr1543_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142903537 4.21E-06 7.74E-09 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251