| Variant ID: vg0142903531 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 42903531 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GAAAAGATAATAACTCTCTCATACTATATTTACTCTAGCAACAAACTCGATGCATGCACCATCCCCAATATTTCCTAGCCAATAGCAAATCAAGATATTG[C/T]
ATGTGGGTTATAAATACTTGTGTGCATGGATACATGCATCAATGTCTATTTACTCCAATACACAAATAACGAATAGACTTAATAAATGAACACAAATATG
CATATTTGTGTTCATTTATTAAGTCTATTCGTTATTTGTGTATTGGAGTAAATAGACATTGATGCATGTATCCATGCACACAAGTATTTATAACCCACAT[G/A]
CAATATCTTGATTTGCTATTGGCTAGGAAATATTGGGGATGGTGCATGCATCGAGTTTGTTGCTAGAGTAAATATAGTATGAGAGAGTTATTATCTTTTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.90% | 7.00% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 88.00% | 12.00% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 76.10% | 23.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 87.20% | 12.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 91.00% | 8.80% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0142903531 | C -> T | LOC_Os01g74090.1 | upstream_gene_variant ; 1512.0bp to feature; MODIFIER | silent_mutation | Average:46.738; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg0142903531 | C -> T | LOC_Os01g74100.1 | upstream_gene_variant ; 854.0bp to feature; MODIFIER | silent_mutation | Average:46.738; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg0142903531 | C -> T | LOC_Os01g74080.1 | downstream_gene_variant ; 3608.0bp to feature; MODIFIER | silent_mutation | Average:46.738; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg0142903531 | C -> T | LOC_Os01g74110.1 | downstream_gene_variant ; 2035.0bp to feature; MODIFIER | silent_mutation | Average:46.738; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg0142903531 | C -> T | LOC_Os01g74090-LOC_Os01g74100 | intergenic_region ; MODIFIER | silent_mutation | Average:46.738; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0142903531 | NA | 1.39E-06 | mr1641 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142903531 | NA | 4.43E-07 | mr1839 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142903531 | NA | 8.20E-06 | mr1959 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142903531 | NA | 3.99E-06 | mr1013_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142903531 | NA | 2.27E-06 | mr1015_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142903531 | NA | 7.04E-06 | mr1031_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142903531 | 4.45E-06 | 4.45E-06 | mr1049_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142903531 | NA | 6.36E-07 | mr1543_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142903531 | 3.69E-06 | 8.70E-09 | mr1904_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/