\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142887146:

Variant ID: vg0142887146 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 42887146
Reference Allele: GTAlternative Allele: AT,G
Primary Allele: GTSecondary Allele: AT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCATGTTTGTCTGAAGAAAACAATTTGGTAGAGTATGTGGTACTCCCTCCATTTCAAATTGATCTATATACTCCCTCCATTCCAAATTGATCTACATATA[GT/AT,G]
TTTTTTCAAATTATTTCTAAATGATCTACATATTTGTGTTCATTCATTAAGTCTATTCGTTATTTGTGCATTGGAGTAAATGGACATTGATGCATGCATC

Reverse complement sequence

GATGCATGCATCAATGTCCATTTACTCCAATGCACAAATAACGAATAGACTTAATGAATGAACACAAATATGTAGATCATTTAGAAATAATTTGAAAAAA[AC/AT,C]
TATATGTAGATCAATTTGGAATGGAGGGAGTATATAGATCAATTTGAAATGGAGGGAGTACCACATACTCTACCAAATTGTTTTCTTCAGACAAACATGG

Allele Frequencies:

Populations Population SizeFrequency of GT(primary allele) Frequency of AT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.10% 10.90% 0.02% 0.00% G: 0.04%
All Indica  2759 85.70% 14.20% 0.00% 0.00% G: 0.04%
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 56.90% 43.10% 0.00% 0.00% NA
Indica I  595 75.50% 24.50% 0.00% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 83.40% 16.50% 0.00% 0.00% G: 0.11%
Indica Intermediate  786 88.40% 11.60% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 5.60% 1.11% 0.00% G: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142887146 GT -> G LOC_Os01g74030.1 upstream_gene_variant ; 4183.0bp to feature; MODIFIER silent_mutation Average:80.267; most accessible tissue: Minghui63 flower, score: 95.5 N N N N
vg0142887146 GT -> G LOC_Os01g74050.1 upstream_gene_variant ; 2298.0bp to feature; MODIFIER silent_mutation Average:80.267; most accessible tissue: Minghui63 flower, score: 95.5 N N N N
vg0142887146 GT -> G LOC_Os01g74060.1 upstream_gene_variant ; 4994.0bp to feature; MODIFIER silent_mutation Average:80.267; most accessible tissue: Minghui63 flower, score: 95.5 N N N N
vg0142887146 GT -> G LOC_Os01g74040.1 downstream_gene_variant ; 731.0bp to feature; MODIFIER silent_mutation Average:80.267; most accessible tissue: Minghui63 flower, score: 95.5 N N N N
vg0142887146 GT -> G LOC_Os01g74040-LOC_Os01g74050 intergenic_region ; MODIFIER silent_mutation Average:80.267; most accessible tissue: Minghui63 flower, score: 95.5 N N N N
vg0142887146 GT -> AT LOC_Os01g74030.1 upstream_gene_variant ; 4182.0bp to feature; MODIFIER silent_mutation Average:80.267; most accessible tissue: Minghui63 flower, score: 95.5 N N N N
vg0142887146 GT -> AT LOC_Os01g74050.1 upstream_gene_variant ; 2299.0bp to feature; MODIFIER silent_mutation Average:80.267; most accessible tissue: Minghui63 flower, score: 95.5 N N N N
vg0142887146 GT -> AT LOC_Os01g74060.1 upstream_gene_variant ; 4995.0bp to feature; MODIFIER silent_mutation Average:80.267; most accessible tissue: Minghui63 flower, score: 95.5 N N N N
vg0142887146 GT -> AT LOC_Os01g74040.1 downstream_gene_variant ; 730.0bp to feature; MODIFIER silent_mutation Average:80.267; most accessible tissue: Minghui63 flower, score: 95.5 N N N N
vg0142887146 GT -> AT LOC_Os01g74040-LOC_Os01g74050 intergenic_region ; MODIFIER silent_mutation Average:80.267; most accessible tissue: Minghui63 flower, score: 95.5 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0142887146 GT AT 0.03 0.01 -0.01 0.0 -0.01 -0.03
vg0142887146 GT G -0.01 0.03 -0.02 -0.02 -0.02 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142887146 NA 3.97E-07 mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142887146 NA 7.97E-06 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142887146 NA 4.54E-07 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142887146 1.46E-06 NA mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142887146 6.12E-07 6.12E-07 mr1249 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142887146 NA 2.48E-06 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142887146 NA 3.07E-06 mr1641 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142887146 NA 3.91E-07 mr1692 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142887146 NA 3.04E-06 mr1735 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142887146 NA 5.76E-07 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142887146 NA 8.85E-08 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142887146 NA 5.41E-09 mr1839 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142887146 NA 5.45E-06 mr1909 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142887146 NA 9.85E-06 mr1959 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142887146 6.12E-07 6.12E-07 mr1985 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142887146 NA 3.40E-06 mr1015_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142887146 NA 2.93E-06 mr1031_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142887146 NA 5.73E-06 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142887146 NA 2.96E-06 mr1683_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142887146 NA 6.80E-06 mr1729_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142887146 NA 8.96E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142887146 NA 4.65E-06 mr1759_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142887146 NA 9.34E-06 mr1759_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142887146 8.95E-06 8.97E-06 mr1985_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251