Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142855337:

Variant ID: vg0142855337 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 42855337
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTGAACTTATATGTTTGTGGAGTGTTATATCACATGTTAATACACCTTTCCAATTTTTTTTAAATTTTTTTATAACCATTTAAGTGACATACAAAAAAC[G/A]
AGGGGATATCCCCTCGAGAGATTAAAACAGTTTCCCTGATGCTCCATATAATACTACTACTACTACAAGAGTAAGCGCCCAGCGTTCATATCATATGCAT

Reverse complement sequence

ATGCATATGATATGAACGCTGGGCGCTTACTCTTGTAGTAGTAGTAGTATTATATGGAGCATCAGGGAAACTGTTTTAATCTCTCGAGGGGATATCCCCT[C/T]
GTTTTTTGTATGTCACTTAAATGGTTATAAAAAAATTTAAAAAAAATTGGAAAGGTGTATTAACATGTGATATAACACTCCACAAACATATAAGTTCAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.00%	8.40%	0.63%	0.00%	NA
All Indica	2759	89.50%	9.40%	1.05%	0.00%	NA
All Japonica	1512	99.90%	0.00%	0.07%	0.00%	NA
Aus	269	50.20%	49.80%	0.00%	0.00%	NA
Indica I	595	71.10%	25.20%	3.70%	0.00%	NA
Indica II	465	98.50%	1.50%	0.00%	0.00%	NA
Indica III	913	95.20%	4.80%	0.00%	0.00%	NA
Indica Intermediate	786	91.60%	7.50%	0.89%	0.00%	NA
Temperate Japonica	767	99.90%	0.00%	0.13%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	3.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0142855337	G -> A	LOC_Os01g73970.1	upstream_gene_variant ; 2327.0bp to feature; MODIFIER	silent_mutation	Average:68.124; most accessible tissue: Minghui63 flag leaf, score: 81.811	N	N	N	N
vg0142855337	G -> A	LOC_Os01g73980.1	upstream_gene_variant ; 320.0bp to feature; MODIFIER	silent_mutation	Average:68.124; most accessible tissue: Minghui63 flag leaf, score: 81.811	N	N	N	N
vg0142855337	G -> A	LOC_Os01g73990.1	upstream_gene_variant ; 3427.0bp to feature; MODIFIER	silent_mutation	Average:68.124; most accessible tissue: Minghui63 flag leaf, score: 81.811	N	N	N	N
vg0142855337	G -> A	LOC_Os01g73980.2	upstream_gene_variant ; 320.0bp to feature; MODIFIER	silent_mutation	Average:68.124; most accessible tissue: Minghui63 flag leaf, score: 81.811	N	N	N	N
vg0142855337	G -> A	LOC_Os01g73970-LOC_Os01g73980	intergenic_region ; MODIFIER	silent_mutation	Average:68.124; most accessible tissue: Minghui63 flag leaf, score: 81.811	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0142855337	NA	8.72E-09	mr1201	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142855337	NA	1.60E-08	mr1201	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142855337	NA	1.30E-06	mr1274	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142855337	NA	2.28E-06	mr1274	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142855337	NA	7.21E-07	mr1662	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142855337	NA	4.00E-10	mr1201_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142855337	NA	3.81E-08	mr1201_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142855337	NA	1.40E-07	mr1219_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142855337	NA	1.08E-09	mr1274_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142855337	NA	1.18E-07	mr1274_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142855337	NA	5.56E-06	mr1295_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142855337	NA	1.72E-08	mr1344_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142855337	NA	2.59E-08	mr1482_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142855337	9.20E-07	NA	mr1541_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142855337	7.68E-06	1.34E-06	mr1704_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142855337	NA	6.80E-09	mr1741_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142855337	NA	3.23E-07	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251