\
| Variant ID: vg0142799943 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 42799943 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AAGATTGATCCTAATAAGGTCATATTCTTTTCTCCAACATTGGATGAAGATTAAGATTTTTGTGGCACGCTTTTCAAACTCCTAAACGGTGCGTTTCATA[C/T]
AAAAATTTTATATATGAAAGTTGCTCTAAAATATCATATTAATCTATTTTTTTTAAGTTTATAATAATTAAAACTCAATCAATCATATATTAATACTACC
GGTAGTATTAATATATGATTGATTGAGTTTTAATTATTATAAACTTAAAAAAAATAGATTAATATGATATTTTAGAGCAACTTTCATATATAAAATTTTT[G/A]
TATGAAACGCACCGTTTAGGAGTTTGAAAAGCGTGCCACAAAAATCTTAATCTTCATCCAATGTTGGAGAAAAGAATATGACCTTATTAGGATCAATCTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.30% | 6.70% | 0.28% | 11.70% | NA |
| All Indica | 2759 | 77.20% | 2.50% | 0.40% | 19.83% | NA |
| All Japonica | 1512 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 50.60% | 49.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 74.30% | 0.20% | 0.00% | 25.55% | NA |
| Indica II | 465 | 97.20% | 0.60% | 0.00% | 2.15% | NA |
| Indica III | 913 | 65.60% | 4.20% | 0.77% | 29.46% | NA |
| Indica Intermediate | 786 | 81.20% | 3.60% | 0.51% | 14.76% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 79.40% | 20.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 7.80% | 2.22% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0142799943 | C -> T | LOC_Os01g73860.1 | upstream_gene_variant ; 453.0bp to feature; MODIFIER | silent_mutation | Average:65.784; most accessible tissue: Callus, score: 89.431 | N | N | N | N |
| vg0142799943 | C -> T | LOC_Os01g73870.1 | upstream_gene_variant ; 4959.0bp to feature; MODIFIER | silent_mutation | Average:65.784; most accessible tissue: Callus, score: 89.431 | N | N | N | N |
| vg0142799943 | C -> T | LOC_Os01g73860-LOC_Os01g73870 | intergenic_region ; MODIFIER | silent_mutation | Average:65.784; most accessible tissue: Callus, score: 89.431 | N | N | N | N |
| vg0142799943 | C -> DEL | N | N | silent_mutation | Average:65.784; most accessible tissue: Callus, score: 89.431 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0142799943 | 1.46E-07 | NA | mr1850 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142799943 | NA | 4.77E-10 | mr1047_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142799943 | NA | 2.56E-08 | mr1808_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142799943 | NA | 4.59E-06 | mr1815_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |