\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142799943:

Variant ID: vg0142799943 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 42799943
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGATTGATCCTAATAAGGTCATATTCTTTTCTCCAACATTGGATGAAGATTAAGATTTTTGTGGCACGCTTTTCAAACTCCTAAACGGTGCGTTTCATA[C/T]
AAAAATTTTATATATGAAAGTTGCTCTAAAATATCATATTAATCTATTTTTTTTAAGTTTATAATAATTAAAACTCAATCAATCATATATTAATACTACC

Reverse complement sequence

GGTAGTATTAATATATGATTGATTGAGTTTTAATTATTATAAACTTAAAAAAAATAGATTAATATGATATTTTAGAGCAACTTTCATATATAAAATTTTT[G/A]
TATGAAACGCACCGTTTAGGAGTTTGAAAAGCGTGCCACAAAAATCTTAATCTTCATCCAATGTTGGAGAAAAGAATATGACCTTATTAGGATCAATCTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.30% 6.70% 0.28% 11.70% NA
All Indica  2759 77.20% 2.50% 0.40% 19.83% NA
All Japonica  1512 92.90% 7.10% 0.00% 0.00% NA
Aus  269 50.60% 49.40% 0.00% 0.00% NA
Indica I  595 74.30% 0.20% 0.00% 25.55% NA
Indica II  465 97.20% 0.60% 0.00% 2.15% NA
Indica III  913 65.60% 4.20% 0.77% 29.46% NA
Indica Intermediate  786 81.20% 3.60% 0.51% 14.76% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 79.40% 20.60% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 83.30% 7.80% 2.22% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142799943 C -> T LOC_Os01g73860.1 upstream_gene_variant ; 453.0bp to feature; MODIFIER silent_mutation Average:65.784; most accessible tissue: Callus, score: 89.431 N N N N
vg0142799943 C -> T LOC_Os01g73870.1 upstream_gene_variant ; 4959.0bp to feature; MODIFIER silent_mutation Average:65.784; most accessible tissue: Callus, score: 89.431 N N N N
vg0142799943 C -> T LOC_Os01g73860-LOC_Os01g73870 intergenic_region ; MODIFIER silent_mutation Average:65.784; most accessible tissue: Callus, score: 89.431 N N N N
vg0142799943 C -> DEL N N silent_mutation Average:65.784; most accessible tissue: Callus, score: 89.431 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142799943 1.46E-07 NA mr1850 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142799943 NA 4.77E-10 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142799943 NA 2.56E-08 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142799943 NA 4.59E-06 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251