Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142773064:

Variant ID: vg0142773064 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 42773064
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGCAGCTTTTGACAGTGTGAGGGACAGATTTCGATCAAGGTTTTCTGAGTTGCAGCAATTTAAGAAAACGCAATGCTGATGGAGACACAGTGGACACCAC[T/A]
ATTACTTTTCTTTTTGTTCGGCAGTTTTATACTGTTGAACACGAACAGTATTTAAGTAGTTTTAAACACAATACTGTTGGAGTAGTTTTGTTTGCCGTGG

Reverse complement sequence

CCACGGCAAACAAAACTACTCCAACAGTATTGTGTTTAAAACTACTTAAATACTGTTCGTGTTCAACAGTATAAAACTGCCGAACAAAAAGAAAAGTAAT[A/T]
GTGGTGTCCACTGTGTCTCCATCAGCATTGCGTTTTCTTAAATTGCTGCAACTCAGAAAACCTTGATCGAAATCTGTCCCTCACACTGTCAAAAGCTGCT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.20%	3.20%	0.97%	2.67%	NA
All Indica	2759	92.10%	5.40%	1.49%	1.01%	NA
All Japonica	1512	93.50%	0.00%	0.20%	6.28%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	75.00%	19.30%	5.71%	0.00%	NA
Indica II	465	98.10%	1.30%	0.22%	0.43%	NA
Indica III	913	97.20%	0.10%	0.22%	2.52%	NA
Indica Intermediate	786	95.80%	3.30%	0.51%	0.38%	NA
Temperate Japonica	767	99.90%	0.00%	0.00%	0.13%	NA
Tropical Japonica	504	81.20%	0.00%	0.60%	18.25%	NA
Japonica Intermediate	241	99.20%	0.00%	0.00%	0.83%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	1.10%	2.22%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0142773064	T -> A	LOC_Os01g73830.1	downstream_gene_variant ; 22.0bp to feature; MODIFIER	silent_mutation	Average:65.314; most accessible tissue: Callus, score: 87.766	N	N	N	N
vg0142773064	T -> A	LOC_Os01g73840.2	downstream_gene_variant ; 1770.0bp to feature; MODIFIER	silent_mutation	Average:65.314; most accessible tissue: Callus, score: 87.766	N	N	N	N
vg0142773064	T -> A	LOC_Os01g73840.1	downstream_gene_variant ; 1770.0bp to feature; MODIFIER	silent_mutation	Average:65.314; most accessible tissue: Callus, score: 87.766	N	N	N	N
vg0142773064	T -> A	LOC_Os01g73830-LOC_Os01g73840	intergenic_region ; MODIFIER	silent_mutation	Average:65.314; most accessible tissue: Callus, score: 87.766	N	N	N	N
vg0142773064	T -> DEL	N	N	silent_mutation	Average:65.314; most accessible tissue: Callus, score: 87.766	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0142773064	NA	1.76E-11	mr1201	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142773064	NA	8.13E-11	mr1201	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142773064	NA	2.36E-08	mr1219	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142773064	NA	1.96E-08	mr1219	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142773064	NA	2.66E-10	mr1274	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142773064	NA	1.92E-08	mr1274	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142773064	NA	1.52E-06	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142773064	NA	4.98E-07	mr1662	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142773064	8.67E-06	NA	mr1075_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142773064	7.55E-06	NA	mr1075_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142773064	1.81E-06	NA	mr1124_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142773064	NA	1.41E-13	mr1201_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142773064	NA	8.54E-13	mr1201_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142773064	NA	1.14E-09	mr1219_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142773064	NA	3.57E-10	mr1219_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142773064	NA	1.16E-12	mr1274_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142773064	NA	1.11E-11	mr1274_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142773064	NA	4.97E-06	mr1592_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251