\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142744866:

Variant ID: vg0142744866 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 42744866
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.53, C: 0.47, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:


TACTTTATTATCTACAGTACTTTAAGCACAACTTTTCGTTTTTTATATTTACAAAAAGAATTTAAATAAGACGAATGGTCAAACGTTGCAAGCAAAAACT[T/C]
AAAATACCTTATATCGTGGGACGGAGGGGGTATAATATGATTCCGGAATTCCCGCGCTGGCGAGCTGTTCAGCGAGGCTTCGGCGCGCGCGGCAGTCGTG

Reverse complement sequence

CACGACTGCCGCGCGCGCCGAAGCCTCGCTGAACAGCTCGCCAGCGCGGGAATTCCGGAATCATATTATACCCCCTCCGTCCCACGATATAAGGTATTTT[A/G]
AGTTTTTGCTTGCAACGTTTGACCATTCGTCTTATTTAAATTCTTTTTGTAAATATAAAAAACGAAAAGTTGTGCTTAAAGTACTGTAGATAATAAAGTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.70% 19.80% 6.77% 5.67% NA
All Indica  2759 54.70% 24.60% 11.24% 9.46% NA
All Japonica  1512 92.30% 7.40% 0.13% 0.20% NA
Aus  269 50.90% 49.10% 0.00% 0.00% NA
Indica I  595 41.50% 26.90% 23.53% 8.07% NA
Indica II  465 53.50% 3.00% 16.99% 26.45% NA
Indica III  913 55.60% 37.70% 4.16% 2.52% NA
Indica Intermediate  786 64.20% 20.50% 6.74% 8.52% NA
Temperate Japonica  767 99.20% 0.50% 0.00% 0.26% NA
Tropical Japonica  504 79.40% 20.60% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 1.70% 0.83% 0.41% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 71.10% 16.70% 7.78% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142744866 T -> DEL N N silent_mutation Average:67.484; most accessible tissue: Zhenshan97 root, score: 93.512 N N N N
vg0142744866 T -> C LOC_Os01g73790.1 upstream_gene_variant ; 2692.0bp to feature; MODIFIER silent_mutation Average:67.484; most accessible tissue: Zhenshan97 root, score: 93.512 N N N N
vg0142744866 T -> C LOC_Os01g73790-LOC_Os01g73800 intergenic_region ; MODIFIER silent_mutation Average:67.484; most accessible tissue: Zhenshan97 root, score: 93.512 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0142744866 T C -0.07 -0.01 0.0 -0.01 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142744866 NA 1.25E-06 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142744866 NA 1.84E-07 mr1201 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142744866 NA 1.47E-07 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142744866 NA 5.74E-09 mr1274 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142744866 NA 1.20E-06 mr1274 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142744866 NA 1.37E-07 mr1838 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142744866 NA 6.44E-09 mr1839 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142744866 NA 1.74E-09 mr1909 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142744866 NA 9.19E-06 mr1921 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142744866 NA 1.69E-06 mr1959 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142744866 NA 9.19E-06 mr1015_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142744866 NA 2.31E-06 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142744866 NA 1.96E-07 mr1200_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142744866 NA 2.16E-06 mr1201_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142744866 NA 1.98E-06 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142744866 NA 1.36E-09 mr1274_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142744866 NA 5.71E-06 mr1388_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142744866 NA 5.22E-08 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142744866 NA 3.37E-06 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142744866 NA 5.75E-06 mr1528_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142744866 NA 1.53E-07 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142744866 NA 8.27E-06 mr1671_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142744866 NA 4.96E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142744866 NA 4.71E-06 mr1759_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142744866 NA 2.18E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142744866 NA 3.57E-09 mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142744866 NA 1.13E-07 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251