\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142709816:

Variant ID: vg0142709816 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 42709816
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.01, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TTCAAAAAATGTAGTTAGTATTTTTTTTATAGAAAAAGTTCAATATGGCTCCCTTAAGATAAGTCAGATTTGATTCATTTCCCTCAACTTCATAAGCCAT[A/G]
ATACCGGATATATCGACCCCTCCAACTATTAATACCAACACAAACGACTTAGATCCAGTTTAAATATTTTGGCTCTTAGAGTCATTTTGTATCCGTTTTA

Reverse complement sequence

TAAAACGGATACAAAATGACTCTAAGAGCCAAAATATTTAAACTGGATCTAAGTCGTTTGTGTTGGTATTAATAGTTGGAGGGGTCGATATATCCGGTAT[T/C]
ATGGCTTATGAAGTTGAGGGAAATGAATCAAATCTGACTTATCTTAAGGGAGCCATATTGAACTTTTTCTATAAAAAAAATACTAACTACATTTTTTGAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.00% 11.70% 0.23% 0.00% NA
All Indica  2759 80.00% 19.60% 0.36% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.07% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 92.60% 7.40% 0.00% 0.00% NA
Indica II  465 36.80% 62.60% 0.65% 0.00% NA
Indica III  913 93.90% 5.90% 0.22% 0.00% NA
Indica Intermediate  786 80.00% 19.30% 0.64% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 0.80% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142709816 A -> G LOC_Os01g73710.1 upstream_gene_variant ; 4441.0bp to feature; MODIFIER silent_mutation Average:43.484; most accessible tissue: Minghui63 root, score: 72.134 N N N N
vg0142709816 A -> G LOC_Os01g73730.1 upstream_gene_variant ; 880.0bp to feature; MODIFIER silent_mutation Average:43.484; most accessible tissue: Minghui63 root, score: 72.134 N N N N
vg0142709816 A -> G LOC_Os01g73720.1 downstream_gene_variant ; 1835.0bp to feature; MODIFIER silent_mutation Average:43.484; most accessible tissue: Minghui63 root, score: 72.134 N N N N
vg0142709816 A -> G LOC_Os01g73740.1 downstream_gene_variant ; 3487.0bp to feature; MODIFIER silent_mutation Average:43.484; most accessible tissue: Minghui63 root, score: 72.134 N N N N
vg0142709816 A -> G LOC_Os01g73720-LOC_Os01g73730 intergenic_region ; MODIFIER silent_mutation Average:43.484; most accessible tissue: Minghui63 root, score: 72.134 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142709816 NA 5.83E-07 mr1749 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142709816 1.34E-10 2.95E-17 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142709816 1.85E-09 1.79E-16 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142709816 1.14E-07 8.22E-08 mr1984 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142709816 4.67E-08 2.37E-10 mr1984 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142709816 NA 8.35E-07 mr1188_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142709816 NA 3.99E-09 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142709816 NA 7.07E-06 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142709816 NA 6.37E-09 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142709816 NA 4.08E-06 mr1942_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142709816 3.35E-09 1.05E-14 mr1974_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142709816 2.00E-08 5.72E-13 mr1974_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251