\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142706516:

Variant ID: vg0142706516 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 42706516
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.58, G: 0.42, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


GGCACTGCACCACGAGGCGCTCTCGCTCGCTTCACCACCACGCGCGCCGGCTCGCCGGCAGTCTTCCCTGCCGAGCACCATGCTTGCATGCTACCTCATG[G/C]
ATGGATCATCTCCATTGCCAGTCCAGTGAAATGCCGGCCTAGCTATAAATACGCGCCTAGCTCTCATAGCCATCTTCCTCACCACCGATCGATCCAGAGT

Reverse complement sequence

ACTCTGGATCGATCGGTGGTGAGGAAGATGGCTATGAGAGCTAGGCGCGTATTTATAGCTAGGCCGGCATTTCACTGGACTGGCAATGGAGATGATCCAT[C/G]
CATGAGGTAGCATGCAAGCATGGTGCTCGGCAGGGAAGACTGCCGGCGAGCCGGCGCGCGTGGTGGTGAAGCGAGCGAGAGCGCCTCGTGGTGCAGTGCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.40% 37.40% 0.15% 0.08% NA
All Indica  2759 77.90% 21.70% 0.25% 0.11% NA
All Japonica  1512 27.90% 72.10% 0.00% 0.00% NA
Aus  269 93.70% 6.30% 0.00% 0.00% NA
Indica I  595 63.90% 36.10% 0.00% 0.00% NA
Indica II  465 78.10% 21.10% 0.65% 0.22% NA
Indica III  913 92.90% 6.90% 0.00% 0.22% NA
Indica Intermediate  786 71.00% 28.50% 0.51% 0.00% NA
Temperate Japonica  767 7.80% 92.20% 0.00% 0.00% NA
Tropical Japonica  504 49.00% 51.00% 0.00% 0.00% NA
Japonica Intermediate  241 47.70% 52.30% 0.00% 0.00% NA
VI/Aromatic  96 78.10% 21.90% 0.00% 0.00% NA
Intermediate  90 54.40% 44.40% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142706516 G -> DEL N N silent_mutation Average:71.559; most accessible tissue: Callus, score: 89.815 N N N N
vg0142706516 G -> C LOC_Os01g73710.1 upstream_gene_variant ; 1141.0bp to feature; MODIFIER silent_mutation Average:71.559; most accessible tissue: Callus, score: 89.815 N N N N
vg0142706516 G -> C LOC_Os01g73720.1 upstream_gene_variant ; 8.0bp to feature; MODIFIER silent_mutation Average:71.559; most accessible tissue: Callus, score: 89.815 N N N N
vg0142706516 G -> C LOC_Os01g73730.1 upstream_gene_variant ; 4180.0bp to feature; MODIFIER silent_mutation Average:71.559; most accessible tissue: Callus, score: 89.815 N N N N
vg0142706516 G -> C LOC_Os01g73710-LOC_Os01g73720 intergenic_region ; MODIFIER silent_mutation Average:71.559; most accessible tissue: Callus, score: 89.815 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142706516 NA 2.50E-07 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706516 NA 3.15E-07 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706516 NA 4.51E-06 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706516 NA 1.29E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706516 NA 2.57E-07 mr1177 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706516 NA 3.65E-07 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706516 7.87E-06 1.57E-11 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706516 NA 3.88E-09 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706516 NA 2.33E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706516 NA 1.98E-07 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706516 NA 3.00E-09 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706516 NA 1.88E-06 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706516 NA 9.66E-07 mr1909 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706516 NA 6.23E-06 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706516 NA 7.17E-07 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706516 NA 4.06E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706516 2.60E-06 2.60E-06 mr1985 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706516 NA 6.68E-07 mr1015_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706516 NA 1.01E-08 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706516 NA 5.10E-09 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706516 NA 7.62E-09 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706516 NA 6.32E-08 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706516 NA 4.97E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706516 NA 2.60E-06 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706516 NA 3.78E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706516 NA 6.32E-07 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706516 1.21E-08 9.90E-13 mr1974_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706516 NA 2.38E-07 mr1974_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706516 NA 7.27E-07 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251