\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142706301:

Variant ID: vg0142706301 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 42706301
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.92, C: 0.08, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:


AAATTTGGTGGCGTGGCATGCTAGAAAAGCTGGACAAAGTACTCCACATGCAAGCTGAAGTTAGCTAGCAAATATTCAGACGCACGCAATGCGTCATGCG[T/C]
TCTCCTGAAGACCTGAAGCTAGATACGGCAGCTGCTGGGAGCTTTCTGATTTGCCACGACGACGTATCGAACGGCCAGCCGCCTTCGCCGCGACGCCGCC

Reverse complement sequence

GGCGGCGTCGCGGCGAAGGCGGCTGGCCGTTCGATACGTCGTCGTGGCAAATCAGAAAGCTCCCAGCAGCTGCCGTATCTAGCTTCAGGTCTTCAGGAGA[A/G]
CGCATGACGCATTGCGTGCGTCTGAATATTTGCTAGCTAACTTCAGCTTGCATGTGGAGTACTTTGTCCAGCTTTTCTAGCATGCCACGCCACCAAATTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.50% 37.30% 0.08% 0.11% NA
All Indica  2759 78.00% 21.70% 0.14% 0.14% NA
All Japonica  1512 27.80% 72.20% 0.00% 0.00% NA
Aus  269 93.70% 6.30% 0.00% 0.00% NA
Indica I  595 64.00% 36.00% 0.00% 0.00% NA
Indica II  465 78.10% 21.10% 0.43% 0.43% NA
Indica III  913 92.90% 6.90% 0.11% 0.11% NA
Indica Intermediate  786 71.20% 28.50% 0.13% 0.13% NA
Temperate Japonica  767 7.80% 92.20% 0.00% 0.00% NA
Tropical Japonica  504 48.80% 51.20% 0.00% 0.00% NA
Japonica Intermediate  241 47.70% 52.30% 0.00% 0.00% NA
VI/Aromatic  96 78.10% 21.90% 0.00% 0.00% NA
Intermediate  90 57.80% 41.10% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142706301 T -> DEL N N silent_mutation Average:66.749; most accessible tissue: Callus, score: 89.449 N N N N
vg0142706301 T -> C LOC_Os01g73700.1 upstream_gene_variant ; 4978.0bp to feature; MODIFIER silent_mutation Average:66.749; most accessible tissue: Callus, score: 89.449 N N N N
vg0142706301 T -> C LOC_Os01g73710.1 upstream_gene_variant ; 926.0bp to feature; MODIFIER silent_mutation Average:66.749; most accessible tissue: Callus, score: 89.449 N N N N
vg0142706301 T -> C LOC_Os01g73720.1 upstream_gene_variant ; 223.0bp to feature; MODIFIER silent_mutation Average:66.749; most accessible tissue: Callus, score: 89.449 N N N N
vg0142706301 T -> C LOC_Os01g73730.1 upstream_gene_variant ; 4395.0bp to feature; MODIFIER silent_mutation Average:66.749; most accessible tissue: Callus, score: 89.449 N N N N
vg0142706301 T -> C LOC_Os01g73710-LOC_Os01g73720 intergenic_region ; MODIFIER silent_mutation Average:66.749; most accessible tissue: Callus, score: 89.449 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142706301 NA 3.20E-07 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706301 NA 2.64E-07 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706301 NA 4.43E-06 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706301 NA 5.69E-12 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706301 NA 1.36E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706301 NA 1.05E-07 mr1177 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706301 NA 3.65E-07 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706301 1.48E-06 3.78E-12 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706301 NA 1.40E-09 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706301 NA 2.33E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706301 NA 2.41E-07 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706301 NA 3.91E-09 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706301 NA 1.88E-06 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706301 NA 1.58E-06 mr1909 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706301 4.38E-06 8.28E-07 mr1974 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706301 NA 1.67E-07 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706301 NA 3.47E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706301 3.75E-06 3.75E-06 mr1985 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706301 NA 1.44E-06 mr1015_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706301 NA 9.98E-09 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706301 NA 9.52E-10 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706301 NA 2.58E-06 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706301 NA 2.30E-08 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706301 NA 7.91E-08 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706301 NA 2.38E-06 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706301 NA 4.32E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706301 NA 3.78E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706301 NA 4.42E-07 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706301 5.48E-08 5.69E-12 mr1974_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706301 NA 4.89E-07 mr1974_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706301 NA 2.88E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251