\
| Variant ID: vg0142706258 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 42706258 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, C: 0.03, others allele: 0.00, population size: 74. )
AACGGATGGTACACAAGTTTTTGTAACAGAGTTTGCTGATTGTAAATTTGGTGGCGTGGCATGCTAGAAAAGCTGGACAAAGTACTCCACATGCAAGCTG[A/C]
AGTTAGCTAGCAAATATTCAGACGCACGCAATGCGTCATGCGTTCTCCTGAAGACCTGAAGCTAGATACGGCAGCTGCTGGGAGCTTTCTGATTTGCCAC
GTGGCAAATCAGAAAGCTCCCAGCAGCTGCCGTATCTAGCTTCAGGTCTTCAGGAGAACGCATGACGCATTGCGTGCGTCTGAATATTTGCTAGCTAACT[T/G]
CAGCTTGCATGTGGAGTACTTTGTCCAGCTTTTCTAGCATGCCACGCCACCAAATTTACAATCAGCAAACTCTGTTACAAAAACTTGTGTACCATCCGTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.70% | 37.80% | 0.40% | 0.11% | NA |
| All Indica | 2759 | 77.00% | 22.30% | 0.54% | 0.14% | NA |
| All Japonica | 1512 | 27.40% | 72.40% | 0.13% | 0.00% | NA |
| Aus | 269 | 93.70% | 6.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 63.40% | 36.30% | 0.34% | 0.00% | NA |
| Indica II | 465 | 75.70% | 22.80% | 1.08% | 0.43% | NA |
| Indica III | 913 | 92.90% | 6.90% | 0.11% | 0.11% | NA |
| Indica Intermediate | 786 | 69.70% | 29.30% | 0.89% | 0.13% | NA |
| Temperate Japonica | 767 | 7.70% | 92.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 48.20% | 51.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 46.90% | 52.30% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 78.10% | 21.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 55.60% | 41.10% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0142706258 | A -> DEL | N | N | silent_mutation | Average:64.757; most accessible tissue: Callus, score: 89.449 | N | N | N | N |
| vg0142706258 | A -> C | LOC_Os01g73700.1 | upstream_gene_variant ; 4935.0bp to feature; MODIFIER | silent_mutation | Average:64.757; most accessible tissue: Callus, score: 89.449 | N | N | N | N |
| vg0142706258 | A -> C | LOC_Os01g73710.1 | upstream_gene_variant ; 883.0bp to feature; MODIFIER | silent_mutation | Average:64.757; most accessible tissue: Callus, score: 89.449 | N | N | N | N |
| vg0142706258 | A -> C | LOC_Os01g73720.1 | upstream_gene_variant ; 266.0bp to feature; MODIFIER | silent_mutation | Average:64.757; most accessible tissue: Callus, score: 89.449 | N | N | N | N |
| vg0142706258 | A -> C | LOC_Os01g73730.1 | upstream_gene_variant ; 4438.0bp to feature; MODIFIER | silent_mutation | Average:64.757; most accessible tissue: Callus, score: 89.449 | N | N | N | N |
| vg0142706258 | A -> C | LOC_Os01g73710-LOC_Os01g73720 | intergenic_region ; MODIFIER | silent_mutation | Average:64.757; most accessible tissue: Callus, score: 89.449 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0142706258 | NA | 8.93E-06 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142706258 | NA | 3.03E-07 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142706258 | NA | 2.46E-07 | mr1109 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142706258 | NA | 3.48E-06 | mr1129 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142706258 | NA | 4.60E-12 | mr1170 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142706258 | NA | 4.83E-07 | mr1170 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142706258 | NA | 4.17E-08 | mr1177 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142706258 | NA | 3.65E-07 | mr1192 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142706258 | 1.21E-06 | 3.38E-12 | mr1236 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142706258 | NA | 1.13E-09 | mr1236 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142706258 | NA | 2.33E-06 | mr1236 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142706258 | NA | 3.12E-07 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142706258 | NA | 7.72E-09 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142706258 | NA | 1.88E-06 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142706258 | NA | 1.52E-06 | mr1909 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142706258 | 7.85E-06 | 1.22E-06 | mr1974 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142706258 | NA | 3.02E-07 | mr1974 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142706258 | NA | 2.08E-06 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142706258 | 4.94E-06 | 4.94E-06 | mr1985 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142706258 | NA | 1.20E-06 | mr1015_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142706258 | NA | 1.36E-08 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142706258 | NA | 1.16E-09 | mr1170_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142706258 | NA | 2.10E-06 | mr1180_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142706258 | NA | 1.38E-08 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142706258 | NA | 7.63E-08 | mr1236_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142706258 | NA | 7.88E-07 | mr1252_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142706258 | NA | 3.61E-06 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142706258 | NA | 3.78E-06 | mr1627_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142706258 | NA | 2.71E-07 | mr1855_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142706258 | 1.82E-07 | 2.03E-11 | mr1974_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142706258 | NA | 7.20E-07 | mr1974_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142706258 | NA | 3.53E-06 | mr1977_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |