\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142706258:

Variant ID: vg0142706258 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 42706258
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, C: 0.03, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:


AACGGATGGTACACAAGTTTTTGTAACAGAGTTTGCTGATTGTAAATTTGGTGGCGTGGCATGCTAGAAAAGCTGGACAAAGTACTCCACATGCAAGCTG[A/C]
AGTTAGCTAGCAAATATTCAGACGCACGCAATGCGTCATGCGTTCTCCTGAAGACCTGAAGCTAGATACGGCAGCTGCTGGGAGCTTTCTGATTTGCCAC

Reverse complement sequence

GTGGCAAATCAGAAAGCTCCCAGCAGCTGCCGTATCTAGCTTCAGGTCTTCAGGAGAACGCATGACGCATTGCGTGCGTCTGAATATTTGCTAGCTAACT[T/G]
CAGCTTGCATGTGGAGTACTTTGTCCAGCTTTTCTAGCATGCCACGCCACCAAATTTACAATCAGCAAACTCTGTTACAAAAACTTGTGTACCATCCGTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.70% 37.80% 0.40% 0.11% NA
All Indica  2759 77.00% 22.30% 0.54% 0.14% NA
All Japonica  1512 27.40% 72.40% 0.13% 0.00% NA
Aus  269 93.70% 6.30% 0.00% 0.00% NA
Indica I  595 63.40% 36.30% 0.34% 0.00% NA
Indica II  465 75.70% 22.80% 1.08% 0.43% NA
Indica III  913 92.90% 6.90% 0.11% 0.11% NA
Indica Intermediate  786 69.70% 29.30% 0.89% 0.13% NA
Temperate Japonica  767 7.70% 92.30% 0.00% 0.00% NA
Tropical Japonica  504 48.20% 51.80% 0.00% 0.00% NA
Japonica Intermediate  241 46.90% 52.30% 0.83% 0.00% NA
VI/Aromatic  96 78.10% 21.90% 0.00% 0.00% NA
Intermediate  90 55.60% 41.10% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142706258 A -> DEL N N silent_mutation Average:64.757; most accessible tissue: Callus, score: 89.449 N N N N
vg0142706258 A -> C LOC_Os01g73700.1 upstream_gene_variant ; 4935.0bp to feature; MODIFIER silent_mutation Average:64.757; most accessible tissue: Callus, score: 89.449 N N N N
vg0142706258 A -> C LOC_Os01g73710.1 upstream_gene_variant ; 883.0bp to feature; MODIFIER silent_mutation Average:64.757; most accessible tissue: Callus, score: 89.449 N N N N
vg0142706258 A -> C LOC_Os01g73720.1 upstream_gene_variant ; 266.0bp to feature; MODIFIER silent_mutation Average:64.757; most accessible tissue: Callus, score: 89.449 N N N N
vg0142706258 A -> C LOC_Os01g73730.1 upstream_gene_variant ; 4438.0bp to feature; MODIFIER silent_mutation Average:64.757; most accessible tissue: Callus, score: 89.449 N N N N
vg0142706258 A -> C LOC_Os01g73710-LOC_Os01g73720 intergenic_region ; MODIFIER silent_mutation Average:64.757; most accessible tissue: Callus, score: 89.449 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142706258 NA 8.93E-06 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706258 NA 3.03E-07 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706258 NA 2.46E-07 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706258 NA 3.48E-06 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706258 NA 4.60E-12 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706258 NA 4.83E-07 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706258 NA 4.17E-08 mr1177 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706258 NA 3.65E-07 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706258 1.21E-06 3.38E-12 mr1236 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706258 NA 1.13E-09 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706258 NA 2.33E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706258 NA 3.12E-07 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706258 NA 7.72E-09 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706258 NA 1.88E-06 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706258 NA 1.52E-06 mr1909 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706258 7.85E-06 1.22E-06 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706258 NA 3.02E-07 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706258 NA 2.08E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706258 4.94E-06 4.94E-06 mr1985 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706258 NA 1.20E-06 mr1015_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706258 NA 1.36E-08 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706258 NA 1.16E-09 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706258 NA 2.10E-06 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706258 NA 1.38E-08 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706258 NA 7.63E-08 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706258 NA 7.88E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706258 NA 3.61E-06 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706258 NA 3.78E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706258 NA 2.71E-07 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706258 1.82E-07 2.03E-11 mr1974_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706258 NA 7.20E-07 mr1974_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706258 NA 3.53E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251