\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142699503:

Variant ID: vg0142699503 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 42699503
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTTCGTTATTTGTAAGGAGTAGAATGATGGATTAGTGTTTTCCAAGCTTTCAAATGGTGCGGTTTTTTTTAAAAAAACTTGTATGCACATAAATTTCTT[G/T]
AAATATAGTTTCAAATACATTTTCAACTTGCGAGAGTTAATTTGTTCGTTTGTACATCTCAATAATTATCACAAACCATTTACTCTCCATTCATTTCATA

Reverse complement sequence

TATGAAATGAATGGAGAGTAAATGGTTTGTGATAATTATTGAGATGTACAAACGAACAAATTAACTCTCGCAAGTTGAAAATGTATTTGAAACTATATTT[C/A]
AAGAAATTTATGTGCATACAAGTTTTTTTAAAAAAAACCGCACCATTTGAAAGCTTGGAAAACACTAATCCATCATTCTACTCCTTACAAATAACGAACT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.60% 2.00% 1.38% 10.03% NA
All Indica  2759 77.70% 3.30% 2.21% 16.82% NA
All Japonica  1512 99.70% 0.10% 0.00% 0.20% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 91.80% 0.70% 0.34% 7.23% NA
Indica II  465 35.90% 9.70% 2.37% 52.04% NA
Indica III  913 88.00% 1.00% 2.85% 8.21% NA
Indica Intermediate  786 79.80% 4.20% 2.80% 13.23% NA
Temperate Japonica  767 99.70% 0.10% 0.00% 0.13% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 0.40% 0.00% 0.83% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 87.80% 1.10% 4.44% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142699503 G -> T LOC_Os01g73690.1 upstream_gene_variant ; 444.0bp to feature; MODIFIER silent_mutation Average:54.285; most accessible tissue: Callus, score: 91.524 N N N N
vg0142699503 G -> T LOC_Os01g73680.1 downstream_gene_variant ; 3445.0bp to feature; MODIFIER silent_mutation Average:54.285; most accessible tissue: Callus, score: 91.524 N N N N
vg0142699503 G -> T LOC_Os01g73700.1 downstream_gene_variant ; 468.0bp to feature; MODIFIER silent_mutation Average:54.285; most accessible tissue: Callus, score: 91.524 N N N N
vg0142699503 G -> T LOC_Os01g73710.1 downstream_gene_variant ; 4779.0bp to feature; MODIFIER silent_mutation Average:54.285; most accessible tissue: Callus, score: 91.524 N N N N
vg0142699503 G -> T LOC_Os01g73690-LOC_Os01g73700 intergenic_region ; MODIFIER silent_mutation Average:54.285; most accessible tissue: Callus, score: 91.524 N N N N
vg0142699503 G -> DEL N N silent_mutation Average:54.285; most accessible tissue: Callus, score: 91.524 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142699503 NA 1.01E-08 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142699503 NA 4.01E-06 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142699503 NA 9.91E-06 mr1651 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142699503 NA 5.17E-07 mr1749 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142699503 NA 8.09E-06 mr1919 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142699503 NA 1.50E-06 mr1919 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142699503 NA 4.23E-06 mr1931 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142699503 7.28E-13 1.12E-19 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142699503 1.67E-11 5.08E-19 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142699503 5.50E-06 2.02E-06 mr1984 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142699503 4.39E-06 1.90E-08 mr1984 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142699503 NA 4.13E-07 mr1188_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142699503 NA 8.70E-10 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142699503 NA 2.22E-06 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142699503 NA 7.92E-07 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142699503 NA 1.79E-09 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142699503 NA 7.54E-06 mr1527_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142699503 NA 9.19E-06 mr1931_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142699503 NA 2.76E-06 mr1942_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142699503 1.31E-12 1.17E-17 mr1974_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142699503 1.39E-11 4.91E-16 mr1974_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251