Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142699503:

Variant ID: vg0142699503 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 42699503
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGTTCGTTATTTGTAAGGAGTAGAATGATGGATTAGTGTTTTCCAAGCTTTCAAATGGTGCGGTTTTTTTTAAAAAAACTTGTATGCACATAAATTTCTT[G/T]
AAATATAGTTTCAAATACATTTTCAACTTGCGAGAGTTAATTTGTTCGTTTGTACATCTCAATAATTATCACAAACCATTTACTCTCCATTCATTTCATA

Reverse complement sequence

TATGAAATGAATGGAGAGTAAATGGTTTGTGATAATTATTGAGATGTACAAACGAACAAATTAACTCTCGCAAGTTGAAAATGTATTTGAAACTATATTT[C/A]
AAGAAATTTATGTGCATACAAGTTTTTTTAAAAAAAACCGCACCATTTGAAAGCTTGGAAAACACTAATCCATCATTCTACTCCTTACAAATAACGAACT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.60%	2.00%	1.38%	10.03%	NA
All Indica	2759	77.70%	3.30%	2.21%	16.82%	NA
All Japonica	1512	99.70%	0.10%	0.00%	0.20%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	91.80%	0.70%	0.34%	7.23%	NA
Indica II	465	35.90%	9.70%	2.37%	52.04%	NA
Indica III	913	88.00%	1.00%	2.85%	8.21%	NA
Indica Intermediate	786	79.80%	4.20%	2.80%	13.23%	NA
Temperate Japonica	767	99.70%	0.10%	0.00%	0.13%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	0.40%	0.00%	0.83%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	87.80%	1.10%	4.44%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0142699503	G -> T	LOC_Os01g73690.1	upstream_gene_variant ; 444.0bp to feature; MODIFIER	silent_mutation	Average:54.285; most accessible tissue: Callus, score: 91.524	N	N	N	N
vg0142699503	G -> T	LOC_Os01g73680.1	downstream_gene_variant ; 3445.0bp to feature; MODIFIER	silent_mutation	Average:54.285; most accessible tissue: Callus, score: 91.524	N	N	N	N
vg0142699503	G -> T	LOC_Os01g73700.1	downstream_gene_variant ; 468.0bp to feature; MODIFIER	silent_mutation	Average:54.285; most accessible tissue: Callus, score: 91.524	N	N	N	N
vg0142699503	G -> T	LOC_Os01g73710.1	downstream_gene_variant ; 4779.0bp to feature; MODIFIER	silent_mutation	Average:54.285; most accessible tissue: Callus, score: 91.524	N	N	N	N
vg0142699503	G -> T	LOC_Os01g73690-LOC_Os01g73700	intergenic_region ; MODIFIER	silent_mutation	Average:54.285; most accessible tissue: Callus, score: 91.524	N	N	N	N
vg0142699503	G -> DEL	N	N	silent_mutation	Average:54.285; most accessible tissue: Callus, score: 91.524	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0142699503	NA	1.01E-08	mr1457	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142699503	NA	4.01E-06	mr1629	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142699503	NA	9.91E-06	mr1651	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142699503	NA	5.17E-07	mr1749	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142699503	NA	8.09E-06	mr1919	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142699503	NA	1.50E-06	mr1919	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142699503	NA	4.23E-06	mr1931	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142699503	7.28E-13	1.12E-19	mr1974	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142699503	1.67E-11	5.08E-19	mr1974	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142699503	5.50E-06	2.02E-06	mr1984	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142699503	4.39E-06	1.90E-08	mr1984	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142699503	NA	4.13E-07	mr1188_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142699503	NA	8.70E-10	mr1322_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142699503	NA	2.22E-06	mr1497_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142699503	NA	7.92E-07	mr1498_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142699503	NA	1.79E-09	mr1527_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142699503	NA	7.54E-06	mr1527_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142699503	NA	9.19E-06	mr1931_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142699503	NA	2.76E-06	mr1942_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142699503	1.31E-12	1.17E-17	mr1974_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142699503	1.39E-11	4.91E-16	mr1974_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251