\
| Variant ID: vg0142695483 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 42695483 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.01, others allele: 0.00, population size: 126. )
TGAGAAGATGGCCTTACACATATCATACTCAGTTACTCAGGCCTGAATGGCAAGTTGAGATTGTAATGCTTATATTGAAATTCCATCCAACCACAGCCGG[A/G]
TCAACAAATGAAATAAATGGCCATCCAAAATTGTTTCGCCAAGATCACATCGGTAAATTCCAACATTCTACAGGTGTTCCAGAATCTCGCCACAAAATAA
TTATTTTGTGGCGAGATTCTGGAACACCTGTAGAATGTTGGAATTTACCGATGTGATCTTGGCGAAACAATTTTGGATGGCCATTTATTTCATTTGTTGA[T/C]
CCGGCTGTGGTTGGATGGAATTTCAATATAAGCATTACAATCTCAACTTGCCATTCAGGCCTGAGTAACTGAGTATGATATGTGTAAGGCCATCTTCTCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.50% | 12.50% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 79.10% | 20.80% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.60% | 8.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 36.30% | 63.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 90.50% | 9.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 81.70% | 18.10% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 10.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0142695483 | A -> G | LOC_Os01g73680.1 | 3_prime_UTR_variant ; 286.0bp to feature; MODIFIER | silent_mutation | Average:64.648; most accessible tissue: Callus, score: 88.135 | N | N | N | N |
| vg0142695483 | A -> G | LOC_Os01g73690.1 | 3_prime_UTR_variant ; 443.0bp to feature; MODIFIER | silent_mutation | Average:64.648; most accessible tissue: Callus, score: 88.135 | N | N | N | N |
| vg0142695483 | A -> G | LOC_Os01g73700.1 | downstream_gene_variant ; 4488.0bp to feature; MODIFIER | silent_mutation | Average:64.648; most accessible tissue: Callus, score: 88.135 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0142695483 | NA | 1.05E-06 | mr1749 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142695483 | NA | 4.60E-06 | mr1919 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142695483 | NA | 7.85E-07 | mr1919 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142695483 | 1.13E-13 | 2.22E-20 | mr1974 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142695483 | 2.31E-12 | 9.49E-20 | mr1974 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142695483 | 1.89E-06 | 7.52E-07 | mr1984 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142695483 | 1.30E-06 | 5.34E-09 | mr1984 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142695483 | NA | 4.17E-07 | mr1188_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142695483 | NA | 2.41E-10 | mr1322_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142695483 | NA | 4.00E-06 | mr1322_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142695483 | NA | 1.97E-08 | mr1449_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142695483 | NA | 1.89E-06 | mr1497_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142695483 | NA | 5.50E-07 | mr1498_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142695483 | NA | 7.67E-10 | mr1527_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142695483 | NA | 3.58E-06 | mr1527_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142695483 | NA | 8.71E-06 | mr1928_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142695483 | NA | 3.00E-06 | mr1931_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142695483 | NA | 2.44E-06 | mr1942_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142695483 | 1.48E-11 | 9.15E-17 | mr1974_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142695483 | 1.17E-10 | 3.59E-15 | mr1974_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |