\
| Variant ID: vg0142688928 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 42688928 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 291. )
TTTTTTTGGGAGGGCTTAGCTTACCTTTCTTTTTATATCAGTATCAGTAGATGTCGATGCCCCGCCAGCGCCTGCAGAAATAAAGATCCCGAACCAATGT[T/A]
TTTTTAGCTGTTATGATTAATTCGGTTTCCAGGCTCCGGCCCGATCGAAAGCATTGTAATTGATAATGTTATGTGCGATACATTTAGCGTACGTTGCAAT
ATTGCAACGTACGCTAAATGTATCGCACATAACATTATCAATTACAATGCTTTCGATCGGGCCGGAGCCTGGAAACCGAATTAATCATAACAGCTAAAAA[A/T]
ACATTGGTTCGGGATCTTTATTTCTGCAGGCGCTGGCGGGGCATCGACATCTACTGATACTGATATAAAAAGAAAGGTAAGCTAAGCCCTCCCAAAAAAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.50% | 12.40% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 79.10% | 20.80% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.40% | 8.60% | 0.00% | 0.00% | NA |
| Indica II | 465 | 36.30% | 63.40% | 0.22% | 0.00% | NA |
| Indica III | 913 | 90.60% | 9.30% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 81.70% | 18.20% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 8.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0142688928 | T -> A | LOC_Os01g73670.1 | 3_prime_UTR_variant ; 121.0bp to feature; MODIFIER | silent_mutation | Average:55.263; most accessible tissue: Callus, score: 82.608 | N | N | N | N |
| vg0142688928 | T -> A | LOC_Os01g73670.2 | 3_prime_UTR_variant ; 121.0bp to feature; MODIFIER | silent_mutation | Average:55.263; most accessible tissue: Callus, score: 82.608 | N | N | N | N |
| vg0142688928 | T -> A | LOC_Os01g73670.3 | 3_prime_UTR_variant ; 121.0bp to feature; MODIFIER | silent_mutation | Average:55.263; most accessible tissue: Callus, score: 82.608 | N | N | N | N |
| vg0142688928 | T -> A | LOC_Os01g73670.4 | 3_prime_UTR_variant ; 751.0bp to feature; MODIFIER | silent_mutation | Average:55.263; most accessible tissue: Callus, score: 82.608 | N | N | N | N |
| vg0142688928 | T -> A | LOC_Os01g73680.1 | upstream_gene_variant ; 965.0bp to feature; MODIFIER | silent_mutation | Average:55.263; most accessible tissue: Callus, score: 82.608 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0142688928 | NA | 1.23E-06 | mr1749 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142688928 | NA | 2.48E-06 | mr1919 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142688928 | NA | 3.18E-07 | mr1919 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142688928 | NA | 4.06E-06 | mr1931 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142688928 | 7.87E-12 | 9.90E-19 | mr1974 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142688928 | 1.97E-10 | 5.81E-18 | mr1974 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142688928 | 9.59E-06 | 3.69E-06 | mr1984 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142688928 | 8.79E-06 | 4.72E-08 | mr1984 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142688928 | NA | 1.49E-06 | mr1188_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142688928 | NA | 1.57E-09 | mr1322_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142688928 | NA | 5.93E-06 | mr1497_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142688928 | NA | 7.54E-09 | mr1527_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142688928 | NA | 4.60E-06 | mr1942_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142688928 | 7.64E-13 | 5.98E-18 | mr1974_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142688928 | 1.11E-11 | 3.49E-16 | mr1974_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |