\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142688928:

Variant ID: vg0142688928 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 42688928
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTTTTGGGAGGGCTTAGCTTACCTTTCTTTTTATATCAGTATCAGTAGATGTCGATGCCCCGCCAGCGCCTGCAGAAATAAAGATCCCGAACCAATGT[T/A]
TTTTTAGCTGTTATGATTAATTCGGTTTCCAGGCTCCGGCCCGATCGAAAGCATTGTAATTGATAATGTTATGTGCGATACATTTAGCGTACGTTGCAAT

Reverse complement sequence

ATTGCAACGTACGCTAAATGTATCGCACATAACATTATCAATTACAATGCTTTCGATCGGGCCGGAGCCTGGAAACCGAATTAATCATAACAGCTAAAAA[A/T]
ACATTGGTTCGGGATCTTTATTTCTGCAGGCGCTGGCGGGGCATCGACATCTACTGATACTGATATAAAAAGAAAGGTAAGCTAAGCCCTCCCAAAAAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.50% 12.40% 0.08% 0.00% NA
All Indica  2759 79.10% 20.80% 0.11% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 91.40% 8.60% 0.00% 0.00% NA
Indica II  465 36.30% 63.40% 0.22% 0.00% NA
Indica III  913 90.60% 9.30% 0.11% 0.00% NA
Indica Intermediate  786 81.70% 18.20% 0.13% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 90.00% 8.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142688928 T -> A LOC_Os01g73670.1 3_prime_UTR_variant ; 121.0bp to feature; MODIFIER silent_mutation Average:55.263; most accessible tissue: Callus, score: 82.608 N N N N
vg0142688928 T -> A LOC_Os01g73670.2 3_prime_UTR_variant ; 121.0bp to feature; MODIFIER silent_mutation Average:55.263; most accessible tissue: Callus, score: 82.608 N N N N
vg0142688928 T -> A LOC_Os01g73670.3 3_prime_UTR_variant ; 121.0bp to feature; MODIFIER silent_mutation Average:55.263; most accessible tissue: Callus, score: 82.608 N N N N
vg0142688928 T -> A LOC_Os01g73670.4 3_prime_UTR_variant ; 751.0bp to feature; MODIFIER silent_mutation Average:55.263; most accessible tissue: Callus, score: 82.608 N N N N
vg0142688928 T -> A LOC_Os01g73680.1 upstream_gene_variant ; 965.0bp to feature; MODIFIER silent_mutation Average:55.263; most accessible tissue: Callus, score: 82.608 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142688928 NA 1.23E-06 mr1749 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142688928 NA 2.48E-06 mr1919 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142688928 NA 3.18E-07 mr1919 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142688928 NA 4.06E-06 mr1931 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142688928 7.87E-12 9.90E-19 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142688928 1.97E-10 5.81E-18 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142688928 9.59E-06 3.69E-06 mr1984 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142688928 8.79E-06 4.72E-08 mr1984 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142688928 NA 1.49E-06 mr1188_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142688928 NA 1.57E-09 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142688928 NA 5.93E-06 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142688928 NA 7.54E-09 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142688928 NA 4.60E-06 mr1942_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142688928 7.64E-13 5.98E-18 mr1974_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142688928 1.11E-11 3.49E-16 mr1974_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251