\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142686538:

Variant ID: vg0142686538 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 42686538
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.01, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


GATGGAATTTTTTATGCGTTTCGAGGAAGATGGCACATTTGATTGGTATTTCTACCCTGATTACTGCTGGCTTGCTGCTCTGAACGACTACCAACGTCTA[G/T]
TACCGATAAACTGTGTACGTATTACATTATATTAATGCATGAATAGTCCTTCAATTCTTCAGTTGTGTCTTGGTGTTCTATTTTGTCAGTTGTTTTTGCA

Reverse complement sequence

TGCAAAAACAACTGACAAAATAGAACACCAAGACACAACTGAAGAATTGAAGGACTATTCATGCATTAATATAATGTAATACGTACACAGTTTATCGGTA[C/A]
TAGACGTTGGTAGTCGTTCAGAGCAGCAAGCCAGCAGTAATCAGGGTAGAAATACCAATCAAATGTGCCATCTTCCTCGAAACGCATAAAAAATTCCATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.00% 36.40% 0.40% 0.21% NA
All Indica  2759 38.00% 61.00% 0.65% 0.36% NA
All Japonica  1512 98.90% 1.10% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 13.30% 85.20% 1.34% 0.17% NA
Indica II  465 73.10% 26.70% 0.22% 0.00% NA
Indica III  913 36.90% 62.50% 0.22% 0.33% NA
Indica Intermediate  786 37.20% 61.20% 0.89% 0.76% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 97.40% 2.60% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 78.90% 20.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142686538 G -> T LOC_Os01g73670.1 missense_variant ; p.Val336Leu; MODERATE nonsynonymous_codon ; V336L Average:61.143; most accessible tissue: Callus, score: 81.22 benign 0.333 TOLERATED 0.05
vg0142686538 G -> T LOC_Os01g73670.2 missense_variant ; p.Val336Leu; MODERATE nonsynonymous_codon ; V336L Average:61.143; most accessible tissue: Callus, score: 81.22 benign 0.333 TOLERATED 0.05
vg0142686538 G -> T LOC_Os01g73670.3 missense_variant ; p.Val336Leu; MODERATE nonsynonymous_codon ; V336L Average:61.143; most accessible tissue: Callus, score: 81.22 benign 0.333 TOLERATED 0.06
vg0142686538 G -> T LOC_Os01g73670.4 missense_variant ; p.Val336Leu; MODERATE nonsynonymous_codon ; V336L Average:61.143; most accessible tissue: Callus, score: 81.22 benign 0.333 TOLERATED 0.06
vg0142686538 G -> DEL LOC_Os01g73670.3 N frameshift_variant Average:61.143; most accessible tissue: Callus, score: 81.22 N N N N
vg0142686538 G -> DEL LOC_Os01g73670.1 N frameshift_variant Average:61.143; most accessible tissue: Callus, score: 81.22 N N N N
vg0142686538 G -> DEL LOC_Os01g73670.4 N frameshift_variant Average:61.143; most accessible tissue: Callus, score: 81.22 N N N N
vg0142686538 G -> DEL LOC_Os01g73670.2 N frameshift_variant Average:61.143; most accessible tissue: Callus, score: 81.22 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142686538 NA 3.50E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142686538 NA 3.70E-06 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142686538 NA 3.18E-08 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142686538 1.09E-10 9.87E-10 mr1974 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142686538 2.53E-08 1.40E-14 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142686538 NA 6.03E-07 mr1984 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142686538 NA 3.16E-06 mr1188_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142686538 NA 9.53E-07 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142686538 NA 8.38E-10 mr1349_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142686538 NA 3.07E-06 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142686538 NA 2.26E-09 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142686538 NA 9.36E-06 mr1899_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142686538 NA 3.72E-06 mr1931_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142686538 NA 5.15E-09 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142686538 NA 2.54E-07 mr1942_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142686538 4.38E-07 NA mr1974_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142686538 2.26E-06 8.36E-10 mr1974_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251