\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142683989:

Variant ID: vg0142683989 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 42683989
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.01, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


CCTAAAATTCTGTAAACAGTGCTTGTGGTGCATCATTCTAAAATGAAAGGAAACGATCGTTTCGAAGATGGTGACTGTAGTGCTAATATTACTCCTAGAT[C/A]
TATGGAATTTATGTTCATTATGTGTTCCATTAGCGGATTTATTGGTAGTCCTAATTGCTCGTTTATTTCACCAACTTGATGTGGTAATATGTTCTATTAT

Reverse complement sequence

ATAATAGAACATATTACCACATCAAGTTGGTGAAATAAACGAGCAATTAGGACTACCAATAAATCCGCTAATGGAACACATAATGAACATAAATTCCATA[G/T]
ATCTAGGAGTAATATTAGCACTACAGTCACCATCTTCGAAACGATCGTTTCCTTTCATTTTAGAATGATGCACCACAAGCACTGTTTACAGAATTTTAGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.70% 12.90% 7.24% 2.12% NA
All Indica  2759 68.90% 20.30% 10.76% 0.00% NA
All Japonica  1512 88.10% 3.20% 2.12% 6.61% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 25.20% 46.60% 28.24% 0.00% NA
Indica II  465 83.00% 9.90% 7.10% 0.00% NA
Indica III  913 87.20% 10.70% 2.08% 0.00% NA
Indica Intermediate  786 72.50% 17.70% 9.80% 0.00% NA
Temperate Japonica  767 98.70% 0.10% 0.39% 0.78% NA
Tropical Japonica  504 68.80% 8.70% 5.16% 17.26% NA
Japonica Intermediate  241 94.60% 1.20% 1.24% 2.90% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 81.10% 4.40% 14.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142683989 C -> A LOC_Os01g73670.1 upstream_gene_variant ; 879.0bp to feature; MODIFIER silent_mutation Average:48.079; most accessible tissue: Callus, score: 81.223 N N N N
vg0142683989 C -> A LOC_Os01g73670.2 upstream_gene_variant ; 879.0bp to feature; MODIFIER silent_mutation Average:48.079; most accessible tissue: Callus, score: 81.223 N N N N
vg0142683989 C -> A LOC_Os01g73670.3 upstream_gene_variant ; 953.0bp to feature; MODIFIER silent_mutation Average:48.079; most accessible tissue: Callus, score: 81.223 N N N N
vg0142683989 C -> A LOC_Os01g73670.4 upstream_gene_variant ; 953.0bp to feature; MODIFIER silent_mutation Average:48.079; most accessible tissue: Callus, score: 81.223 N N N N
vg0142683989 C -> A LOC_Os01g73662.1 downstream_gene_variant ; 3443.0bp to feature; MODIFIER silent_mutation Average:48.079; most accessible tissue: Callus, score: 81.223 N N N N
vg0142683989 C -> A LOC_Os01g73662-LOC_Os01g73670 intergenic_region ; MODIFIER silent_mutation Average:48.079; most accessible tissue: Callus, score: 81.223 N N N N
vg0142683989 C -> DEL N N silent_mutation Average:48.079; most accessible tissue: Callus, score: 81.223 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142683989 8.05E-08 5.60E-35 mr1026 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142683989 1.02E-07 2.25E-21 mr1026 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142683989 NA 5.85E-06 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142683989 3.88E-09 7.76E-22 mr1118 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142683989 4.87E-07 NA mr1161 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142683989 1.02E-06 3.41E-19 mr1161 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142683989 NA 2.03E-06 mr1242 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142683989 1.17E-07 5.32E-24 mr1495 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142683989 NA 2.46E-10 mr1496 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142683989 NA 3.58E-08 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142683989 NA 2.86E-07 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142683989 NA 6.83E-06 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142683989 NA 7.92E-06 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142683989 NA 1.78E-15 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142683989 NA 3.65E-22 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142683989 NA 8.21E-08 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142683989 NA 7.33E-06 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142683989 2.55E-07 7.03E-33 mr1161_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142683989 NA 3.35E-19 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142683989 NA 7.62E-06 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142683989 NA 7.41E-25 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142683989 NA 2.28E-08 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142683989 NA 6.81E-13 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142683989 NA 1.00E-08 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142683989 NA 9.17E-07 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251