Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142638768:

Variant ID: vg0142638768 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 42638768
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.73, A: 0.28, others allele: 0.00, population size: 177. )

Flanking Sequence (100 bp) in Reference Genome:

ATTCAAACAGATGCTAACGATGCAAGTTAGAAGAGAGGTAAATCCATAAGTCATAACAACTCCAACTCCAACACTCAACTATCAAATATAGCTGATTCTG[G/A]
CCCAGTTCTCTTAGACAAAGGCGTTTGGACATTGCTAAGAGCGACGTAGCAAAGAGGCAATCCTCGACACAAGACTATATAGATAACTCATTTCGGGTTT

Reverse complement sequence

AAACCCGAAATGAGTTATCTATATAGTCTTGTGTCGAGGATTGCCTCTTTGCTACGTCGCTCTTAGCAATGTCCAAACGCCTTTGTCTAAGAGAACTGGG[C/T]
CAGAATCAGCTATATTTGATAGTTGAGTGTTGGAGTTGGAGTTGTTATGACTTATGGATTTACCTCTCTTCTAACTTGCATCGTTAGCATCTGTTTGAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.60%	38.30%	0.04%	0.00%	NA
All Indica	2759	37.50%	62.40%	0.04%	0.00%	NA
All Japonica	1512	98.90%	1.10%	0.00%	0.00%	NA
Aus	269	81.00%	19.00%	0.00%	0.00%	NA
Indica I	595	40.30%	59.70%	0.00%	0.00%	NA
Indica II	465	68.20%	31.80%	0.00%	0.00%	NA
Indica III	913	22.20%	77.70%	0.11%	0.00%	NA
Indica Intermediate	786	35.10%	64.90%	0.00%	0.00%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	97.40%	2.60%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	76.70%	22.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0142638768	G -> A	LOC_Os01g73590.1	upstream_gene_variant ; 863.0bp to feature; MODIFIER	silent_mutation	Average:37.155; most accessible tissue: Callus, score: 68.071	N	N	N	N
vg0142638768	G -> A	LOC_Os01g73604.1	downstream_gene_variant ; 88.0bp to feature; MODIFIER	silent_mutation	Average:37.155; most accessible tissue: Callus, score: 68.071	N	N	N	N
vg0142638768	G -> A	LOC_Os01g73590-LOC_Os01g73604	intergenic_region ; MODIFIER	silent_mutation	Average:37.155; most accessible tissue: Callus, score: 68.071	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0142638768	NA	2.27E-10	mr1151	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142638768	NA	6.23E-08	mr1249	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142638768	2.31E-10	7.42E-11	mr1974	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142638768	4.35E-09	8.24E-15	mr1974	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142638768	NA	2.06E-06	mr1896_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142638768	9.99E-09	3.05E-06	mr1974_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142638768	8.35E-08	1.49E-11	mr1974_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142638768	NA	4.27E-06	mr1984_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251