\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142638768:

Variant ID: vg0142638768 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 42638768
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.73, A: 0.28, others allele: 0.00, population size: 177. )

Flanking Sequence (100 bp) in Reference Genome:


ATTCAAACAGATGCTAACGATGCAAGTTAGAAGAGAGGTAAATCCATAAGTCATAACAACTCCAACTCCAACACTCAACTATCAAATATAGCTGATTCTG[G/A]
CCCAGTTCTCTTAGACAAAGGCGTTTGGACATTGCTAAGAGCGACGTAGCAAAGAGGCAATCCTCGACACAAGACTATATAGATAACTCATTTCGGGTTT

Reverse complement sequence

AAACCCGAAATGAGTTATCTATATAGTCTTGTGTCGAGGATTGCCTCTTTGCTACGTCGCTCTTAGCAATGTCCAAACGCCTTTGTCTAAGAGAACTGGG[C/T]
CAGAATCAGCTATATTTGATAGTTGAGTGTTGGAGTTGGAGTTGTTATGACTTATGGATTTACCTCTCTTCTAACTTGCATCGTTAGCATCTGTTTGAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.60% 38.30% 0.04% 0.00% NA
All Indica  2759 37.50% 62.40% 0.04% 0.00% NA
All Japonica  1512 98.90% 1.10% 0.00% 0.00% NA
Aus  269 81.00% 19.00% 0.00% 0.00% NA
Indica I  595 40.30% 59.70% 0.00% 0.00% NA
Indica II  465 68.20% 31.80% 0.00% 0.00% NA
Indica III  913 22.20% 77.70% 0.11% 0.00% NA
Indica Intermediate  786 35.10% 64.90% 0.00% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 97.40% 2.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 76.70% 22.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142638768 G -> A LOC_Os01g73590.1 upstream_gene_variant ; 863.0bp to feature; MODIFIER silent_mutation Average:37.155; most accessible tissue: Callus, score: 68.071 N N N N
vg0142638768 G -> A LOC_Os01g73604.1 downstream_gene_variant ; 88.0bp to feature; MODIFIER silent_mutation Average:37.155; most accessible tissue: Callus, score: 68.071 N N N N
vg0142638768 G -> A LOC_Os01g73590-LOC_Os01g73604 intergenic_region ; MODIFIER silent_mutation Average:37.155; most accessible tissue: Callus, score: 68.071 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142638768 NA 2.27E-10 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142638768 NA 6.23E-08 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142638768 2.31E-10 7.42E-11 mr1974 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142638768 4.35E-09 8.24E-15 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142638768 NA 2.06E-06 mr1896_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142638768 9.99E-09 3.05E-06 mr1974_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142638768 8.35E-08 1.49E-11 mr1974_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142638768 NA 4.27E-06 mr1984_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251