Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142633231:

Variant ID: vg0142633231 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 42633231
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.54, C: 0.46, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:

GGATGGCAAAAAAAAAACTAAATTTTAAATTTTCAAATTTGATTTTGAGATATTTTTAAGGTAGTTTTTTTTTCAGCATTGGCTTTTAAGTCAAAAAACA[T/C]
ATATATAAAAGTTTTACCTATAAATCCATTTTTATTCCCTAATAAATAGTTTTGGCTTATTATGAAAAAAACCAAACGATGGGGCTCTCAGACTCTTCTA

Reverse complement sequence

TAGAAGAGTCTGAGAGCCCCATCGTTTGGTTTTTTTCATAATAAGCCAAAACTATTTATTAGGGAATAAAAATGGATTTATAGGTAAAACTTTTATATAT[A/G]
TGTTTTTTGACTTAAAAGCCAATGCTGAAAAAAAAACTACCTTAAAAATATCTCAAAATCAAATTTGAAAATTTAAAATTTAGTTTTTTTTTTGCCATCC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.60%	28.70%	1.52%	0.23%	NA
All Indica	2759	74.00%	23.20%	2.43%	0.40%	NA
All Japonica	1512	72.90%	26.90%	0.26%	0.00%	NA
Aus	269	23.40%	76.60%	0.00%	0.00%	NA
Indica I	595	90.80%	9.10%	0.17%	0.00%	NA
Indica II	465	31.00%	65.20%	3.44%	0.43%	NA
Indica III	913	83.80%	11.70%	3.50%	0.99%	NA
Indica Intermediate	786	75.30%	22.40%	2.29%	0.00%	NA
Temperate Japonica	767	87.70%	12.10%	0.13%	0.00%	NA
Tropical Japonica	504	58.50%	41.10%	0.40%	0.00%	NA
Japonica Intermediate	241	55.60%	44.00%	0.41%	0.00%	NA
VI/Aromatic	96	27.10%	72.90%	0.00%	0.00%	NA
Intermediate	90	63.30%	35.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0142633231	T -> DEL	N	N	silent_mutation	Average:59.428; most accessible tissue: Callus, score: 80.714	N	N	N	N
vg0142633231	T -> C	LOC_Os01g73580.1	downstream_gene_variant ; 2791.0bp to feature; MODIFIER	silent_mutation	Average:59.428; most accessible tissue: Callus, score: 80.714	N	N	N	N
vg0142633231	T -> C	LOC_Os01g73590.1	downstream_gene_variant ; 2497.0bp to feature; MODIFIER	silent_mutation	Average:59.428; most accessible tissue: Callus, score: 80.714	N	N	N	N
vg0142633231	T -> C	LOC_Os01g73580-LOC_Os01g73590	intergenic_region ; MODIFIER	silent_mutation	Average:59.428; most accessible tissue: Callus, score: 80.714	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0142633231	NA	1.13E-06	mr1090	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142633231	NA	9.70E-08	mr1236	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142633231	NA	6.72E-07	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142633231	NA	4.53E-06	mr1629	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142633231	NA	6.06E-07	mr1919	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142633231	1.03E-09	3.17E-14	mr1974	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142633231	7.99E-11	7.09E-19	mr1974	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142633231	NA	1.86E-07	mr1984	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142633231	NA	3.23E-07	mr1188_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142633231	NA	2.43E-06	mr1322_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142633231	NA	5.78E-06	mr1627_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142633231	NA	7.26E-07	mr1942_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142633231	1.08E-12	2.26E-16	mr1974_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142633231	7.16E-09	2.53E-13	mr1974_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142633231	NA	3.41E-06	mr1984_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251