Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142632661:

Variant ID: vg0142632661 (JBrowse)	Variation Type: INDEL
Chromosome: chr01	Position: 42632661
Reference Allele: GT	Alternative Allele: AT,G
Primary Allele: GT	Secondary Allele: AT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTTCTGTCGGCGTGACCTTCCTGAAGGCTTCGTTTTAGGAGTTTATCTCTTGTTGGACAACTGTACTTAGGTTCAGTTTGTCAATGTCGGGGTTTTGCCG[GT/AT,G]
TTTCCTTTAATTAACCGTGCTGTTGTAAGGTTTTTGGGTCCGGTTTCCCTTATAAACTGGATCAACTCTCTTCTTCTATAGTGAATTGCAGGAGCTCCCT

Reverse complement sequence

AGGGAGCTCCTGCAATTCACTATAGAAGAAGAGAGTTGATCCAGTTTATAAGGGAAACCGGACCCAAAAACCTTACAACAGCACGGTTAATTAAAGGAAA[AC/AT,C]
CGGCAAAACCCCGACATTGACAAACTGAACCTAAGTACAGTTGTCCAACAAGAGATAAACTCCTAAAACGAAGCCTTCAGGAAGGTCACGCCGACAGAAC

Allele Frequencies:

Populations	Population Size	Frequency of GT(primary allele)	Frequency of AT(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.80%	10.70%	0.93%	6.50%	G: 0.02%
All Indica	2759	73.60%	17.80%	1.52%	7.10%	G: 0.04%
All Japonica	1512	93.70%	0.30%	0.13%	5.89%	NA
Aus	269	94.40%	0.00%	0.00%	5.58%	NA
Indica I	595	91.10%	6.40%	0.34%	2.18%	NA
Indica II	465	30.50%	51.80%	4.30%	13.12%	G: 0.22%
Indica III	913	81.70%	10.00%	0.88%	7.45%	NA
Indica Intermediate	786	76.30%	15.30%	1.53%	6.87%	NA
Temperate Japonica	767	99.50%	0.30%	0.00%	0.26%	NA
Tropical Japonica	504	82.90%	0.00%	0.40%	16.67%	NA
Japonica Intermediate	241	97.50%	1.20%	0.00%	1.24%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	78.90%	13.30%	0.00%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0142632661	GT -> G	LOC_Os01g73580.1	downstream_gene_variant ; 2222.0bp to feature; MODIFIER	silent_mutation	Average:53.303; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0142632661	GT -> G	LOC_Os01g73590.1	downstream_gene_variant ; 3066.0bp to feature; MODIFIER	silent_mutation	Average:53.303; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0142632661	GT -> G	LOC_Os01g73580-LOC_Os01g73590	intergenic_region ; MODIFIER	silent_mutation	Average:53.303; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0142632661	GT -> DEL	N	N	silent_mutation	Average:53.303; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0142632661	GT -> AT	LOC_Os01g73580.1	downstream_gene_variant ; 2221.0bp to feature; MODIFIER	silent_mutation	Average:53.303; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0142632661	GT -> AT	LOC_Os01g73590.1	downstream_gene_variant ; 3067.0bp to feature; MODIFIER	silent_mutation	Average:53.303; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0142632661	GT -> AT	LOC_Os01g73580-LOC_Os01g73590	intergenic_region ; MODIFIER	silent_mutation	Average:53.303; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0142632661	NA	5.11E-07	mr1090	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632661	NA	4.26E-09	mr1457	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632661	NA	4.48E-06	mr1500	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632661	NA	1.36E-06	mr1629	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632661	NA	4.24E-06	mr1651	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632661	NA	5.57E-07	mr1749	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632661	NA	9.72E-07	mr1919	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632661	NA	1.55E-07	mr1919	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632661	NA	4.37E-06	mr1931	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632661	1.26E-13	2.32E-20	mr1974	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632661	6.11E-12	1.25E-19	mr1974	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632661	8.94E-07	4.55E-07	mr1984	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632661	2.56E-06	1.05E-08	mr1984	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632661	NA	1.05E-06	mr1188_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632661	NA	9.25E-11	mr1322_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632661	NA	2.00E-06	mr1322_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632661	NA	3.36E-09	mr1449_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632661	NA	3.47E-07	mr1497_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632661	NA	1.98E-08	mr1498_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632661	NA	7.00E-06	mr1508_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632661	NA	3.80E-09	mr1527_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632661	NA	6.07E-07	mr1942_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632661	8.76E-10	6.12E-15	mr1974_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632661	6.00E-09	2.20E-13	mr1974_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251