\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142632661:

Variant ID: vg0142632661 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 42632661
Reference Allele: GTAlternative Allele: AT,G
Primary Allele: GTSecondary Allele: AT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTCTGTCGGCGTGACCTTCCTGAAGGCTTCGTTTTAGGAGTTTATCTCTTGTTGGACAACTGTACTTAGGTTCAGTTTGTCAATGTCGGGGTTTTGCCG[GT/AT,G]
TTTCCTTTAATTAACCGTGCTGTTGTAAGGTTTTTGGGTCCGGTTTCCCTTATAAACTGGATCAACTCTCTTCTTCTATAGTGAATTGCAGGAGCTCCCT

Reverse complement sequence

AGGGAGCTCCTGCAATTCACTATAGAAGAAGAGAGTTGATCCAGTTTATAAGGGAAACCGGACCCAAAAACCTTACAACAGCACGGTTAATTAAAGGAAA[AC/AT,C]
CGGCAAAACCCCGACATTGACAAACTGAACCTAAGTACAGTTGTCCAACAAGAGATAAACTCCTAAAACGAAGCCTTCAGGAAGGTCACGCCGACAGAAC

Allele Frequencies:

Populations Population SizeFrequency of GT(primary allele) Frequency of AT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.80% 10.70% 0.93% 6.50% G: 0.02%
All Indica  2759 73.60% 17.80% 1.52% 7.10% G: 0.04%
All Japonica  1512 93.70% 0.30% 0.13% 5.89% NA
Aus  269 94.40% 0.00% 0.00% 5.58% NA
Indica I  595 91.10% 6.40% 0.34% 2.18% NA
Indica II  465 30.50% 51.80% 4.30% 13.12% G: 0.22%
Indica III  913 81.70% 10.00% 0.88% 7.45% NA
Indica Intermediate  786 76.30% 15.30% 1.53% 6.87% NA
Temperate Japonica  767 99.50% 0.30% 0.00% 0.26% NA
Tropical Japonica  504 82.90% 0.00% 0.40% 16.67% NA
Japonica Intermediate  241 97.50% 1.20% 0.00% 1.24% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 78.90% 13.30% 0.00% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142632661 GT -> G LOC_Os01g73580.1 downstream_gene_variant ; 2222.0bp to feature; MODIFIER silent_mutation Average:53.303; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0142632661 GT -> G LOC_Os01g73590.1 downstream_gene_variant ; 3066.0bp to feature; MODIFIER silent_mutation Average:53.303; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0142632661 GT -> G LOC_Os01g73580-LOC_Os01g73590 intergenic_region ; MODIFIER silent_mutation Average:53.303; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0142632661 GT -> DEL N N silent_mutation Average:53.303; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0142632661 GT -> AT LOC_Os01g73580.1 downstream_gene_variant ; 2221.0bp to feature; MODIFIER silent_mutation Average:53.303; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0142632661 GT -> AT LOC_Os01g73590.1 downstream_gene_variant ; 3067.0bp to feature; MODIFIER silent_mutation Average:53.303; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0142632661 GT -> AT LOC_Os01g73580-LOC_Os01g73590 intergenic_region ; MODIFIER silent_mutation Average:53.303; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142632661 NA 5.11E-07 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632661 NA 4.26E-09 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632661 NA 4.48E-06 mr1500 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632661 NA 1.36E-06 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632661 NA 4.24E-06 mr1651 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632661 NA 5.57E-07 mr1749 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632661 NA 9.72E-07 mr1919 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632661 NA 1.55E-07 mr1919 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632661 NA 4.37E-06 mr1931 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632661 1.26E-13 2.32E-20 mr1974 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632661 6.11E-12 1.25E-19 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632661 8.94E-07 4.55E-07 mr1984 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632661 2.56E-06 1.05E-08 mr1984 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632661 NA 1.05E-06 mr1188_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632661 NA 9.25E-11 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632661 NA 2.00E-06 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632661 NA 3.36E-09 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632661 NA 3.47E-07 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632661 NA 1.98E-08 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632661 NA 7.00E-06 mr1508_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632661 NA 3.80E-09 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632661 NA 6.07E-07 mr1942_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632661 8.76E-10 6.12E-15 mr1974_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632661 6.00E-09 2.20E-13 mr1974_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251