\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142632450:

Variant ID: vg0142632450 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 42632450
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


GGTGACATTTGGTAGCTCCCGTCGTGGATGCTATAGTTGATGGGTGCTCCAAGGCGAAAGTCTTGCTCCGCTCTCGGTGCTAGCAACGGCGACGCCCTTG[G/A]
GCGCCGTTCACTTTCTTGAAGGCGTTTGCTACTGGAGCCCTCGTTCAACTCCACTTCAAGAGTTTTCTCTGGGTGAAAACCTAGATTCGTTAGGATCGGA

Reverse complement sequence

TCCGATCCTAACGAATCTAGGTTTTCACCCAGAGAAAACTCTTGAAGTGGAGTTGAACGAGGGCTCCAGTAGCAAACGCCTTCAAGAAAGTGAACGGCGC[C/T]
CAAGGGCGTCGCCGTTGCTAGCACCGAGAGCGGAGCAAGACTTTCGCCTTGGAGCACCCATCAACTATAGCATCCACGACGGGAGCTACCAAATGTCACC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.40% 15.80% 1.46% 9.25% NA
All Indica  2759 61.10% 26.40% 1.99% 10.51% NA
All Japonica  1512 91.90% 0.90% 0.33% 6.81% NA
Aus  269 84.00% 0.00% 2.60% 13.38% NA
Indica I  595 71.30% 28.20% 0.00% 0.50% NA
Indica II  465 73.30% 19.80% 0.65% 6.24% NA
Indica III  913 51.20% 23.90% 3.50% 21.47% NA
Indica Intermediate  786 57.80% 31.80% 2.54% 7.89% NA
Temperate Japonica  767 99.50% 0.30% 0.00% 0.26% NA
Tropical Japonica  504 77.60% 2.40% 0.79% 19.25% NA
Japonica Intermediate  241 97.90% 0.00% 0.41% 1.66% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 82.20% 7.80% 1.11% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142632450 G -> A LOC_Os01g73580.1 downstream_gene_variant ; 2010.0bp to feature; MODIFIER silent_mutation Average:72.397; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N
vg0142632450 G -> A LOC_Os01g73590.1 downstream_gene_variant ; 3278.0bp to feature; MODIFIER silent_mutation Average:72.397; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N
vg0142632450 G -> A LOC_Os01g73580-LOC_Os01g73590 intergenic_region ; MODIFIER silent_mutation Average:72.397; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N
vg0142632450 G -> DEL N N silent_mutation Average:72.397; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142632450 NA 5.94E-08 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632450 NA 8.56E-06 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632450 NA 2.30E-07 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632450 NA 2.95E-08 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632450 NA 1.21E-06 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632450 NA 6.11E-08 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632450 NA 4.80E-08 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632450 NA 3.08E-08 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632450 NA 2.76E-06 mr1480_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632450 NA 6.31E-07 mr1896_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632450 NA 3.76E-06 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632450 NA 1.05E-06 mr1974_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251