Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142632450:

Variant ID: vg0142632450 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 42632450
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

GGTGACATTTGGTAGCTCCCGTCGTGGATGCTATAGTTGATGGGTGCTCCAAGGCGAAAGTCTTGCTCCGCTCTCGGTGCTAGCAACGGCGACGCCCTTG[G/A]
GCGCCGTTCACTTTCTTGAAGGCGTTTGCTACTGGAGCCCTCGTTCAACTCCACTTCAAGAGTTTTCTCTGGGTGAAAACCTAGATTCGTTAGGATCGGA

Reverse complement sequence

TCCGATCCTAACGAATCTAGGTTTTCACCCAGAGAAAACTCTTGAAGTGGAGTTGAACGAGGGCTCCAGTAGCAAACGCCTTCAAGAAAGTGAACGGCGC[C/T]
CAAGGGCGTCGCCGTTGCTAGCACCGAGAGCGGAGCAAGACTTTCGCCTTGGAGCACCCATCAACTATAGCATCCACGACGGGAGCTACCAAATGTCACC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.40%	15.80%	1.46%	9.25%	NA
All Indica	2759	61.10%	26.40%	1.99%	10.51%	NA
All Japonica	1512	91.90%	0.90%	0.33%	6.81%	NA
Aus	269	84.00%	0.00%	2.60%	13.38%	NA
Indica I	595	71.30%	28.20%	0.00%	0.50%	NA
Indica II	465	73.30%	19.80%	0.65%	6.24%	NA
Indica III	913	51.20%	23.90%	3.50%	21.47%	NA
Indica Intermediate	786	57.80%	31.80%	2.54%	7.89%	NA
Temperate Japonica	767	99.50%	0.30%	0.00%	0.26%	NA
Tropical Japonica	504	77.60%	2.40%	0.79%	19.25%	NA
Japonica Intermediate	241	97.90%	0.00%	0.41%	1.66%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	82.20%	7.80%	1.11%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0142632450	G -> A	LOC_Os01g73580.1	downstream_gene_variant ; 2010.0bp to feature; MODIFIER	silent_mutation	Average:72.397; most accessible tissue: Zhenshan97 panicle, score: 83.41	N	N	N	N
vg0142632450	G -> A	LOC_Os01g73590.1	downstream_gene_variant ; 3278.0bp to feature; MODIFIER	silent_mutation	Average:72.397; most accessible tissue: Zhenshan97 panicle, score: 83.41	N	N	N	N
vg0142632450	G -> A	LOC_Os01g73580-LOC_Os01g73590	intergenic_region ; MODIFIER	silent_mutation	Average:72.397; most accessible tissue: Zhenshan97 panicle, score: 83.41	N	N	N	N
vg0142632450	G -> DEL	N	N	silent_mutation	Average:72.397; most accessible tissue: Zhenshan97 panicle, score: 83.41	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0142632450	NA	5.94E-08	mr1109	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632450	NA	8.56E-06	mr1129	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632450	NA	2.30E-07	mr1236	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632450	NA	2.95E-08	mr1236	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632450	NA	1.21E-06	mr1974	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632450	NA	6.11E-08	mr1974	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632450	NA	4.80E-08	mr1236_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632450	NA	3.08E-08	mr1236_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632450	NA	2.76E-06	mr1480_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632450	NA	6.31E-07	mr1896_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632450	NA	3.76E-06	mr1951_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142632450	NA	1.05E-06	mr1974_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251