\
| Variant ID: vg0142632450 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 42632450 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 105. )
GGTGACATTTGGTAGCTCCCGTCGTGGATGCTATAGTTGATGGGTGCTCCAAGGCGAAAGTCTTGCTCCGCTCTCGGTGCTAGCAACGGCGACGCCCTTG[G/A]
GCGCCGTTCACTTTCTTGAAGGCGTTTGCTACTGGAGCCCTCGTTCAACTCCACTTCAAGAGTTTTCTCTGGGTGAAAACCTAGATTCGTTAGGATCGGA
TCCGATCCTAACGAATCTAGGTTTTCACCCAGAGAAAACTCTTGAAGTGGAGTTGAACGAGGGCTCCAGTAGCAAACGCCTTCAAGAAAGTGAACGGCGC[C/T]
CAAGGGCGTCGCCGTTGCTAGCACCGAGAGCGGAGCAAGACTTTCGCCTTGGAGCACCCATCAACTATAGCATCCACGACGGGAGCTACCAAATGTCACC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.40% | 15.80% | 1.46% | 9.25% | NA |
| All Indica | 2759 | 61.10% | 26.40% | 1.99% | 10.51% | NA |
| All Japonica | 1512 | 91.90% | 0.90% | 0.33% | 6.81% | NA |
| Aus | 269 | 84.00% | 0.00% | 2.60% | 13.38% | NA |
| Indica I | 595 | 71.30% | 28.20% | 0.00% | 0.50% | NA |
| Indica II | 465 | 73.30% | 19.80% | 0.65% | 6.24% | NA |
| Indica III | 913 | 51.20% | 23.90% | 3.50% | 21.47% | NA |
| Indica Intermediate | 786 | 57.80% | 31.80% | 2.54% | 7.89% | NA |
| Temperate Japonica | 767 | 99.50% | 0.30% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 77.60% | 2.40% | 0.79% | 19.25% | NA |
| Japonica Intermediate | 241 | 97.90% | 0.00% | 0.41% | 1.66% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 7.80% | 1.11% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0142632450 | G -> A | LOC_Os01g73580.1 | downstream_gene_variant ; 2010.0bp to feature; MODIFIER | silent_mutation | Average:72.397; most accessible tissue: Zhenshan97 panicle, score: 83.41 | N | N | N | N |
| vg0142632450 | G -> A | LOC_Os01g73590.1 | downstream_gene_variant ; 3278.0bp to feature; MODIFIER | silent_mutation | Average:72.397; most accessible tissue: Zhenshan97 panicle, score: 83.41 | N | N | N | N |
| vg0142632450 | G -> A | LOC_Os01g73580-LOC_Os01g73590 | intergenic_region ; MODIFIER | silent_mutation | Average:72.397; most accessible tissue: Zhenshan97 panicle, score: 83.41 | N | N | N | N |
| vg0142632450 | G -> DEL | N | N | silent_mutation | Average:72.397; most accessible tissue: Zhenshan97 panicle, score: 83.41 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0142632450 | NA | 5.94E-08 | mr1109 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142632450 | NA | 8.56E-06 | mr1129 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142632450 | NA | 2.30E-07 | mr1236 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142632450 | NA | 2.95E-08 | mr1236 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142632450 | NA | 1.21E-06 | mr1974 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142632450 | NA | 6.11E-08 | mr1974 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142632450 | NA | 4.80E-08 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142632450 | NA | 3.08E-08 | mr1236_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142632450 | NA | 2.76E-06 | mr1480_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142632450 | NA | 6.31E-07 | mr1896_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142632450 | NA | 3.76E-06 | mr1951_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142632450 | NA | 1.05E-06 | mr1974_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |