\
| Variant ID: vg0142615783 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 42615783 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.87, A: 0.13, others allele: 0.00, population size: 250. )
GTTTGGTTTATCAGGTGGCCTTTGCCAGAGAAGAAGTTCAGGAGCTACAGAAGAACCCTGAGAGATTTCTTCAGGAATCACTTAATCTAGTTGGATACAC[A/G]
GGTGCTCTTGCAAATCCACTAGTAGCCCCTGAGGAGAGTCTCACACGAATCAATGGCAGTATTATTCAAAAGTTCTATCACGTAATTCTCTTGCTTCTGT
ACAGAAGCAAGAGAATTACGTGATAGAACTTTTGAATAATACTGCCATTGATTCGTGTGAGACTCTCCTCAGGGGCTACTAGTGGATTTGCAAGAGCACC[T/C]
GTGTATCCAACTAGATTAAGTGATTCCTGAAGAAATCTCTCAGGGTTCTTCTGTAGCTCCTGAACTTCTTCTCTGGCAAAGGCCACCTGATAAACCAAAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.20% | 36.40% | 0.32% | 0.11% | NA |
| All Indica | 2759 | 56.90% | 42.50% | 0.43% | 0.14% | NA |
| All Japonica | 1512 | 88.10% | 11.80% | 0.07% | 0.00% | NA |
| Aus | 269 | 6.30% | 93.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 89.70% | 9.90% | 0.34% | 0.00% | NA |
| Indica II | 465 | 26.00% | 72.70% | 0.86% | 0.43% | NA |
| Indica III | 913 | 47.80% | 52.00% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 60.90% | 38.30% | 0.51% | 0.25% | NA |
| Temperate Japonica | 767 | 94.30% | 5.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 76.00% | 23.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 24.00% | 76.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 50.00% | 46.70% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0142615783 | A -> G | LOC_Os01g73550.1 | synonymous_variant ; p.Thr209Thr; LOW | synonymous_codon | Average:70.027; most accessible tissue: Callus, score: 81.361 | N | N | N | N |
| vg0142615783 | A -> G | LOC_Os01g73550.2 | synonymous_variant ; p.Thr209Thr; LOW | synonymous_codon | Average:70.027; most accessible tissue: Callus, score: 81.361 | N | N | N | N |
| vg0142615783 | A -> DEL | LOC_Os01g73550.1 | N | frameshift_variant | Average:70.027; most accessible tissue: Callus, score: 81.361 | N | N | N | N |
| vg0142615783 | A -> DEL | LOC_Os01g73550.2 | N | frameshift_variant | Average:70.027; most accessible tissue: Callus, score: 81.361 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0142615783 | NA | 3.58E-06 | mr1170 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142615783 | NA | 7.61E-06 | mr1188 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142615783 | NA | 1.99E-06 | mr1291 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142615783 | NA | 1.48E-06 | mr1629 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142615783 | NA | 1.91E-06 | mr1919 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142615783 | NA | 8.68E-06 | mr1919 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142615783 | NA | 7.38E-08 | mr1974 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142615783 | 2.28E-07 | 1.21E-13 | mr1974 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142615783 | NA | 1.46E-07 | mr1984 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142615783 | NA | 2.74E-09 | mr1188_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142615783 | NA | 2.54E-06 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142615783 | NA | 2.65E-06 | mr1931_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142615783 | NA | 8.66E-07 | mr1942_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142615783 | NA | 2.51E-09 | mr1974_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |