Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142589694:

Variant ID: vg0142589694 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 42589694
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


TCGTCGTCGGGTTCGCTTGGGTACTCGATCATAGAGTGCCGGTGCTAGTGAGCAGATGCAGGAACCATCTAGCCACCGGTCTTCCCAGAAGAGCGTAGTC[G/A]
TGCCATCACCAATCTGTCAAGTCATGGATGCAGCCACGAAACACTGTTCTTTCGGAGAACAGGGGATGGAAAGGCCTTGCCAAAGAAGAAGAGATATGAT

Reverse complement sequence

ATCATATCTCTTCTTCTTTGGCAAGGCCTTTCCATCCCCTGTTCTCCGAAAGAACAGTGTTTCGTGGCTGCATCCATGACTTGACAGATTGGTGATGGCA[C/T]
GACTACGCTCTTCTGGGAAGACCGGTGGCTAGATGGTTCCTGCATCTGCTCACTAGCACCGGCACTCTATGATCGAGTACCCAAGCGAACCCGACGACGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.60% 10.10% 1.06% 7.24% NA
All Indica  2759 73.00% 16.70% 1.41% 8.84% NA
All Japonica  1512 93.20% 0.30% 0.60% 5.89% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 89.60% 7.40% 1.01% 2.02% NA
Indica II  465 32.30% 50.30% 2.80% 14.62% NA
Indica III  913 80.70% 7.60% 0.77% 10.95% NA
Indica Intermediate  786 75.60% 14.60% 1.65% 8.14% NA
Temperate Japonica  767 99.60% 0.30% 0.13% 0.00% NA
Tropical Japonica  504 81.20% 0.00% 1.39% 17.46% NA
Japonica Intermediate  241 97.90% 1.20% 0.41% 0.41% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 78.90% 11.10% 2.22% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142589694 G -> A LOC_Os01g73490.1 upstream_gene_variant ; 3624.0bp to feature; MODIFIER silent_mutation Average:90.521; most accessible tissue: Minghui63 flag leaf, score: 96.417 N N N N
vg0142589694 G -> A LOC_Os01g73514.1 downstream_gene_variant ; 1187.0bp to feature; MODIFIER silent_mutation Average:90.521; most accessible tissue: Minghui63 flag leaf, score: 96.417 N N N N
vg0142589694 G -> A LOC_Os01g73500.1 intron_variant ; MODIFIER silent_mutation Average:90.521; most accessible tissue: Minghui63 flag leaf, score: 96.417 N N N N
vg0142589694 G -> A LOC_Os01g73500.2 intron_variant ; MODIFIER silent_mutation Average:90.521; most accessible tissue: Minghui63 flag leaf, score: 96.417 N N N N
vg0142589694 G -> DEL N N silent_mutation Average:90.521; most accessible tissue: Minghui63 flag leaf, score: 96.417 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0142589694 G A 0.0 0.01 0.0 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142589694 NA 4.32E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142589694 NA 1.00E-08 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142589694 NA 5.29E-06 mr1500 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142589694 NA 7.52E-06 mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142589694 NA 2.82E-07 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142589694 NA 7.64E-07 mr1749 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142589694 NA 4.75E-06 mr1919 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142589694 NA 1.80E-07 mr1919 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142589694 6.58E-12 9.13E-18 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142589694 2.23E-10 3.96E-17 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142589694 2.01E-06 9.37E-07 mr1984 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142589694 NA 4.15E-08 mr1984 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142589694 NA 5.62E-08 mr1170_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142589694 NA 8.95E-08 mr1188_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142589694 NA 1.74E-09 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142589694 NA 7.84E-07 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142589694 NA 4.16E-06 mr1508_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142589694 NA 3.91E-08 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142589694 NA 4.31E-06 mr1942_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142589694 1.39E-06 6.59E-12 mr1974_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142589694 5.17E-07 1.42E-11 mr1974_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251