\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142534585:

Variant ID: vg0142534585 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 42534585
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCTACAAACATAATCAAACTTAAAGCAGTTTGACTTTGACAAAAGTCAAAACGTCTTATAATCTGAAACAGAGGTAACTTCAACAGCAGGTGCCATTTC[T/A]
TTGAGTAATGGAATTCAACTTGTATAAGACGGTGCAAAATTCTATTAATAGAGCAGGAGAAAAATTACAAGATTACAACCCTAGGTCATGTCGTAACCAG

Reverse complement sequence

CTGGTTACGACATGACCTAGGGTTGTAATCTTGTAATTTTTCTCCTGCTCTATTAATAGAATTTTGCACCGTCTTATACAAGTTGAATTCCATTACTCAA[A/T]
GAAATGGCACCTGCTGTTGAAGTTACCTCTGTTTCAGATTATAAGACGTTTTGACTTTTGTCAAAGTCAAACTGCTTTAAGTTTGATTATGTTTGTAGAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.90% 21.50% 2.67% 0.00% NA
All Indica  2759 98.10% 1.40% 0.51% 0.00% NA
All Japonica  1512 31.70% 61.30% 7.01% 0.00% NA
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 98.90% 0.60% 0.43% 0.00% NA
Indica III  913 95.90% 3.00% 1.10% 0.00% NA
Indica Intermediate  786 98.70% 1.00% 0.25% 0.00% NA
Temperate Japonica  767 35.70% 64.00% 0.26% 0.00% NA
Tropical Japonica  504 30.60% 49.60% 19.84% 0.00% NA
Japonica Intermediate  241 21.20% 77.20% 1.66% 0.00% NA
VI/Aromatic  96 77.10% 21.90% 1.04% 0.00% NA
Intermediate  90 70.00% 24.40% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142534585 T -> A LOC_Os01g73380.1 upstream_gene_variant ; 2740.0bp to feature; MODIFIER silent_mutation Average:50.891; most accessible tissue: Zhenshan97 root, score: 91.642 N N N N
vg0142534585 T -> A LOC_Os01g73390.1 upstream_gene_variant ; 632.0bp to feature; MODIFIER silent_mutation Average:50.891; most accessible tissue: Zhenshan97 root, score: 91.642 N N N N
vg0142534585 T -> A LOC_Os01g73400.1 upstream_gene_variant ; 3103.0bp to feature; MODIFIER silent_mutation Average:50.891; most accessible tissue: Zhenshan97 root, score: 91.642 N N N N
vg0142534585 T -> A LOC_Os01g73390-LOC_Os01g73400 intergenic_region ; MODIFIER silent_mutation Average:50.891; most accessible tissue: Zhenshan97 root, score: 91.642 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0142534585 T A -0.02 0.0 0.0 0.01 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142534585 NA 4.17E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142534585 1.79E-06 NA mr1533_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142534585 NA 3.05E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142534585 NA 4.10E-09 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142534585 NA 1.04E-11 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142534585 NA 7.50E-12 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142534585 NA 2.89E-09 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251