\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142491945:

Variant ID: vg0142491945 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 42491945
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.62, G: 0.38, others allele: 0.00, population size: 66. )

Flanking Sequence (100 bp) in Reference Genome:


CGGTGTGACTTGCTGAGTACTGTGGTTGTACTCATTCTTGCTCTATCTTTCCCCCCTTCAGTAAGAGAAGCTTTGGAGAAGAAGTCTTAGGTGGAGTCCT[A/G]
GCTTATACCCCAGTTGAGCGCCTGTGAAGATGGAGCCATAGGCCCGCTAGTCCGCTGCTGTTTATTTTTGTTTGTCAGGCCTGAAGTGCCTTTGTAATAA

Reverse complement sequence

TTATTACAAAGGCACTTCAGGCCTGACAAACAAAAATAAACAGCAGCGGACTAGCGGGCCTATGGCTCCATCTTCACAGGCGCTCAACTGGGGTATAAGC[T/C]
AGGACTCCACCTAAGACTTCTTCTCCAAAGCTTCTCTTACTGAAGGGGGGAAAGATAGAGCAAGAATGAGTACAACCACAGTACTCAGCAAGTCACACCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.60% 19.60% 0.99% 1.82% NA
All Indica  2759 67.70% 31.00% 1.12% 0.22% NA
All Japonica  1512 93.70% 0.50% 0.93% 4.96% NA
Aus  269 82.90% 16.70% 0.00% 0.37% NA
Indica I  595 90.40% 9.20% 0.34% 0.00% NA
Indica II  465 33.10% 64.50% 1.94% 0.43% NA
Indica III  913 68.00% 30.60% 1.20% 0.22% NA
Indica Intermediate  786 70.60% 28.00% 1.15% 0.25% NA
Temperate Japonica  767 99.70% 0.10% 0.00% 0.13% NA
Tropical Japonica  504 82.70% 0.60% 2.38% 14.29% NA
Japonica Intermediate  241 97.10% 1.20% 0.83% 0.83% NA
VI/Aromatic  96 96.90% 2.10% 1.04% 0.00% NA
Intermediate  90 73.30% 21.10% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142491945 A -> G LOC_Os01g73310.1 upstream_gene_variant ; 4494.0bp to feature; MODIFIER silent_mutation Average:39.622; most accessible tissue: Zhenshan97 flag leaf, score: 58.104 N N N N
vg0142491945 A -> G LOC_Os01g73310-LOC_Os01g73320 intergenic_region ; MODIFIER silent_mutation Average:39.622; most accessible tissue: Zhenshan97 flag leaf, score: 58.104 N N N N
vg0142491945 A -> DEL N N silent_mutation Average:39.622; most accessible tissue: Zhenshan97 flag leaf, score: 58.104 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142491945 NA 9.41E-06 mr1919 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142491945 NA 3.79E-08 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142491945 NA 9.09E-09 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142491945 NA 4.06E-06 mr1984 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142491945 NA 1.93E-07 mr1188_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142491945 4.96E-06 NA mr1480_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142491945 NA 2.68E-07 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142491945 NA 1.44E-06 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142491945 NA 5.69E-06 mr1931_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142491945 NA 5.85E-06 mr1931_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142491945 NA 6.91E-07 mr1942_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142491945 NA 5.77E-07 mr1974_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142491945 NA 6.69E-07 mr1974_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251