\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142482027:

Variant ID: vg0142482027 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 42482027
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.80, A: 0.21, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


ACAATCCCCAGAGAACCGCTTACTCAAGCAGTGACAACATTAGTAAACCCTTCGTTTCATATTATAAATCGCTTTGACTTTTTTTCTTAGTTAATTTTTT[A/T]
AAAAAAGTTTGATCACGCTTATAGAAAAATATAGTAACATTTCTAAGACAACAAACATATTATCAAAATATATTCAAACATATTATCAAAATATATTCAA

Reverse complement sequence

TTGAATATATTTTGATAATATGTTTGAATATATTTTGATAATATGTTTGTTGTCTTAGAAATGTTACTATATTTTTCTATAAGCGTGATCAAACTTTTTT[T/A]
AAAAAATTAACTAAGAAAAAAAGTCAAAGCGATTTATAATATGAAACGAAGGGTTTACTAATGTTGTCACTGCTTGAGTAAGCGGTTCTCTGGGGATTGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 25.20% 25.20% 1.44% 48.10% NA
All Indica  2759 1.20% 35.70% 1.49% 61.58% NA
All Japonica  1512 72.80% 8.10% 1.52% 17.53% NA
Aus  269 3.00% 18.60% 0.74% 77.70% NA
Indica I  595 1.50% 13.10% 3.53% 81.85% NA
Indica II  465 0.60% 69.70% 1.08% 28.60% NA
Indica III  913 0.50% 34.80% 0.22% 64.40% NA
Indica Intermediate  786 2.00% 33.80% 1.65% 62.47% NA
Temperate Japonica  767 66.40% 0.90% 2.74% 29.99% NA
Tropical Japonica  504 76.40% 21.00% 0.00% 2.58% NA
Japonica Intermediate  241 85.90% 4.10% 0.83% 9.13% NA
VI/Aromatic  96 21.90% 8.30% 0.00% 69.79% NA
Intermediate  90 33.30% 27.80% 2.22% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142482027 A -> T LOC_Os01g73310.1 downstream_gene_variant ; 2046.0bp to feature; MODIFIER silent_mutation Average:33.686; most accessible tissue: Callus, score: 74.787 N N N N
vg0142482027 A -> T LOC_Os01g73300.1 intron_variant ; MODIFIER silent_mutation Average:33.686; most accessible tissue: Callus, score: 74.787 N N N N
vg0142482027 A -> DEL N N silent_mutation Average:33.686; most accessible tissue: Callus, score: 74.787 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142482027 NA 1.23E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142482027 4.69E-06 NA mr1329 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142482027 NA 9.56E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142482027 NA 2.57E-10 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142482027 NA 1.40E-08 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142482027 NA 4.41E-06 mr1749 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142482027 NA 5.60E-06 mr1919 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142482027 NA 2.55E-06 mr1919 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142482027 1.90E-06 4.07E-11 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142482027 4.15E-08 3.13E-14 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142482027 NA 7.40E-07 mr1984 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142482027 NA 9.26E-15 mr1188_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142482027 NA 7.15E-07 mr1188_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142482027 NA 4.04E-06 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142482027 NA 2.57E-07 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142482027 NA 8.02E-08 mr1974_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251