\
| Variant ID: vg0142482027 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 42482027 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.80, A: 0.21, others allele: 0.00, population size: 94. )
ACAATCCCCAGAGAACCGCTTACTCAAGCAGTGACAACATTAGTAAACCCTTCGTTTCATATTATAAATCGCTTTGACTTTTTTTCTTAGTTAATTTTTT[A/T]
AAAAAAGTTTGATCACGCTTATAGAAAAATATAGTAACATTTCTAAGACAACAAACATATTATCAAAATATATTCAAACATATTATCAAAATATATTCAA
TTGAATATATTTTGATAATATGTTTGAATATATTTTGATAATATGTTTGTTGTCTTAGAAATGTTACTATATTTTTCTATAAGCGTGATCAAACTTTTTT[T/A]
AAAAAATTAACTAAGAAAAAAAGTCAAAGCGATTTATAATATGAAACGAAGGGTTTACTAATGTTGTCACTGCTTGAGTAAGCGGTTCTCTGGGGATTGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 25.20% | 25.20% | 1.44% | 48.10% | NA |
| All Indica | 2759 | 1.20% | 35.70% | 1.49% | 61.58% | NA |
| All Japonica | 1512 | 72.80% | 8.10% | 1.52% | 17.53% | NA |
| Aus | 269 | 3.00% | 18.60% | 0.74% | 77.70% | NA |
| Indica I | 595 | 1.50% | 13.10% | 3.53% | 81.85% | NA |
| Indica II | 465 | 0.60% | 69.70% | 1.08% | 28.60% | NA |
| Indica III | 913 | 0.50% | 34.80% | 0.22% | 64.40% | NA |
| Indica Intermediate | 786 | 2.00% | 33.80% | 1.65% | 62.47% | NA |
| Temperate Japonica | 767 | 66.40% | 0.90% | 2.74% | 29.99% | NA |
| Tropical Japonica | 504 | 76.40% | 21.00% | 0.00% | 2.58% | NA |
| Japonica Intermediate | 241 | 85.90% | 4.10% | 0.83% | 9.13% | NA |
| VI/Aromatic | 96 | 21.90% | 8.30% | 0.00% | 69.79% | NA |
| Intermediate | 90 | 33.30% | 27.80% | 2.22% | 36.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0142482027 | A -> T | LOC_Os01g73310.1 | downstream_gene_variant ; 2046.0bp to feature; MODIFIER | silent_mutation | Average:33.686; most accessible tissue: Callus, score: 74.787 | N | N | N | N |
| vg0142482027 | A -> T | LOC_Os01g73300.1 | intron_variant ; MODIFIER | silent_mutation | Average:33.686; most accessible tissue: Callus, score: 74.787 | N | N | N | N |
| vg0142482027 | A -> DEL | N | N | silent_mutation | Average:33.686; most accessible tissue: Callus, score: 74.787 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0142482027 | NA | 1.23E-06 | mr1170 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142482027 | 4.69E-06 | NA | mr1329 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142482027 | NA | 9.56E-06 | mr1432 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142482027 | NA | 2.57E-10 | mr1524 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142482027 | NA | 1.40E-08 | mr1629 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142482027 | NA | 4.41E-06 | mr1749 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142482027 | NA | 5.60E-06 | mr1919 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142482027 | NA | 2.55E-06 | mr1919 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142482027 | 1.90E-06 | 4.07E-11 | mr1974 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142482027 | 4.15E-08 | 3.13E-14 | mr1974 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142482027 | NA | 7.40E-07 | mr1984 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142482027 | NA | 9.26E-15 | mr1188_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142482027 | NA | 7.15E-07 | mr1188_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142482027 | NA | 4.04E-06 | mr1497_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142482027 | NA | 2.57E-07 | mr1498_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142482027 | NA | 8.02E-08 | mr1974_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |