Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142478677:

Variant ID: vg0142478677 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 42478677
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAGTTCCGAATCCGTTTTCGTTTCCAAAAAATTTCCGACCGACAGATTCCGTTTTCGAAAATAGGTCCGGAACCGGAAAGTTTCCGTACTGTTTTTATCT[A/C]
TACTGACAACCATCATATATTGTTGGGCCGTATATGTAGAAGTATGTCTATCTAGGTTCAAGAGGCCCATATATCCATATGTACATGTATATATTCAGAT

Reverse complement sequence

ATCTGAATATATACATGTACATATGGATATATGGGCCTCTTGAACCTAGATAGACATACTTCTACATATACGGCCCAACAATATATGATGGTTGTCAGTA[T/G]
AGATAAAAACAGTACGGAAACTTTCCGGTTCCGGACCTATTTTCGAAAACGGAATCTGTCGGTCGGAAATTTTTTGGAAACGAAAACGGATTCGGAACTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.30%	25.00%	0.02%	2.67%	NA
All Indica	2759	98.50%	0.90%	0.04%	0.51%	NA
All Japonica	1512	20.10%	72.80%	0.00%	7.08%	NA
Aus	269	97.40%	2.60%	0.00%	0.00%	NA
Indica I	595	98.80%	1.20%	0.00%	0.00%	NA
Indica II	465	98.50%	0.90%	0.00%	0.65%	NA
Indica III	913	98.50%	0.40%	0.00%	1.10%	NA
Indica Intermediate	786	98.30%	1.40%	0.13%	0.13%	NA
Temperate Japonica	767	33.50%	66.40%	0.00%	0.13%	NA
Tropical Japonica	504	3.80%	76.00%	0.00%	20.24%	NA
Japonica Intermediate	241	11.60%	86.70%	0.00%	1.66%	NA
VI/Aromatic	96	77.10%	21.90%	0.00%	1.04%	NA
Intermediate	90	65.60%	30.00%	0.00%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0142478677	A -> DEL	N	N	silent_mutation	Average:45.449; most accessible tissue: Callus, score: 67.439	N	N	N	N
vg0142478677	A -> C	LOC_Os01g73290.1	upstream_gene_variant ; 3306.0bp to feature; MODIFIER	silent_mutation	Average:45.449; most accessible tissue: Callus, score: 67.439	N	N	N	N
vg0142478677	A -> C	LOC_Os01g73280.1	downstream_gene_variant ; 4607.0bp to feature; MODIFIER	silent_mutation	Average:45.449; most accessible tissue: Callus, score: 67.439	N	N	N	N
vg0142478677	A -> C	LOC_Os01g73300.1	downstream_gene_variant ; 986.0bp to feature; MODIFIER	silent_mutation	Average:45.449; most accessible tissue: Callus, score: 67.439	N	N	N	N
vg0142478677	A -> C	LOC_Os01g73290-LOC_Os01g73300	intergenic_region ; MODIFIER	silent_mutation	Average:45.449; most accessible tissue: Callus, score: 67.439	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0142478677	NA	2.57E-06	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142478677	NA	1.15E-13	mr1449	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142478677	NA	4.75E-39	mr1480	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142478677	NA	1.38E-07	mr1527	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142478677	NA	9.05E-21	mr1627	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142478677	NA	8.59E-14	mr1641	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142478677	NA	3.22E-09	mr1806	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142478677	NA	3.05E-10	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142478677	NA	4.50E-18	mr1968	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142478677	NA	7.60E-06	mr1992	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142478677	NA	1.76E-06	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142478677	5.57E-06	9.74E-51	mr1480_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142478677	NA	1.81E-09	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142478677	NA	5.61E-07	mr1574_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142478677	NA	3.65E-10	mr1646_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142478677	NA	5.67E-12	mr1714_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142478677	NA	3.80E-11	mr1806_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142478677	NA	3.37E-09	mr1835_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142478677	1.68E-07	8.38E-26	mr1968_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142478677	NA	3.07E-06	mr1992_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251