\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142478677:

Variant ID: vg0142478677 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 42478677
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGTTCCGAATCCGTTTTCGTTTCCAAAAAATTTCCGACCGACAGATTCCGTTTTCGAAAATAGGTCCGGAACCGGAAAGTTTCCGTACTGTTTTTATCT[A/C]
TACTGACAACCATCATATATTGTTGGGCCGTATATGTAGAAGTATGTCTATCTAGGTTCAAGAGGCCCATATATCCATATGTACATGTATATATTCAGAT

Reverse complement sequence

ATCTGAATATATACATGTACATATGGATATATGGGCCTCTTGAACCTAGATAGACATACTTCTACATATACGGCCCAACAATATATGATGGTTGTCAGTA[T/G]
AGATAAAAACAGTACGGAAACTTTCCGGTTCCGGACCTATTTTCGAAAACGGAATCTGTCGGTCGGAAATTTTTTGGAAACGAAAACGGATTCGGAACTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.30% 25.00% 0.02% 2.67% NA
All Indica  2759 98.50% 0.90% 0.04% 0.51% NA
All Japonica  1512 20.10% 72.80% 0.00% 7.08% NA
Aus  269 97.40% 2.60% 0.00% 0.00% NA
Indica I  595 98.80% 1.20% 0.00% 0.00% NA
Indica II  465 98.50% 0.90% 0.00% 0.65% NA
Indica III  913 98.50% 0.40% 0.00% 1.10% NA
Indica Intermediate  786 98.30% 1.40% 0.13% 0.13% NA
Temperate Japonica  767 33.50% 66.40% 0.00% 0.13% NA
Tropical Japonica  504 3.80% 76.00% 0.00% 20.24% NA
Japonica Intermediate  241 11.60% 86.70% 0.00% 1.66% NA
VI/Aromatic  96 77.10% 21.90% 0.00% 1.04% NA
Intermediate  90 65.60% 30.00% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142478677 A -> DEL N N silent_mutation Average:45.449; most accessible tissue: Callus, score: 67.439 N N N N
vg0142478677 A -> C LOC_Os01g73290.1 upstream_gene_variant ; 3306.0bp to feature; MODIFIER silent_mutation Average:45.449; most accessible tissue: Callus, score: 67.439 N N N N
vg0142478677 A -> C LOC_Os01g73280.1 downstream_gene_variant ; 4607.0bp to feature; MODIFIER silent_mutation Average:45.449; most accessible tissue: Callus, score: 67.439 N N N N
vg0142478677 A -> C LOC_Os01g73300.1 downstream_gene_variant ; 986.0bp to feature; MODIFIER silent_mutation Average:45.449; most accessible tissue: Callus, score: 67.439 N N N N
vg0142478677 A -> C LOC_Os01g73290-LOC_Os01g73300 intergenic_region ; MODIFIER silent_mutation Average:45.449; most accessible tissue: Callus, score: 67.439 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142478677 NA 2.57E-06 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142478677 NA 1.15E-13 mr1449 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142478677 NA 4.75E-39 mr1480 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142478677 NA 1.38E-07 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142478677 NA 9.05E-21 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142478677 NA 8.59E-14 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142478677 NA 3.22E-09 mr1806 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142478677 NA 3.05E-10 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142478677 NA 4.50E-18 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142478677 NA 7.60E-06 mr1992 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142478677 NA 1.76E-06 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142478677 5.57E-06 9.74E-51 mr1480_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142478677 NA 1.81E-09 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142478677 NA 5.61E-07 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142478677 NA 3.65E-10 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142478677 NA 5.67E-12 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142478677 NA 3.80E-11 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142478677 NA 3.37E-09 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142478677 1.68E-07 8.38E-26 mr1968_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142478677 NA 3.07E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251