Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142475082:

Variant ID: vg0142475082 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 42475082
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

TATACATGTTTATGTTATTTTATAGAACTAATTAATATAAAATAACATAATTGTGTTCTTTGGTAGGTGCAAGGTTACTTTTTTGTGCTGAAAAAGAATG[T/C]
GACAAAACTGTATACATAGATAGATGCAACATAATATAGCTCTAACTAATACAGGATATCGTAATTATGTTCTTTAGTAGGTGCAATGTTAGTTTCTTCT

Reverse complement sequence

AGAAGAAACTAACATTGCACCTACTAAAGAACATAATTACGATATCCTGTATTAGTTAGAGCTATATTATGTTGCATCTATCTATGTATACAGTTTTGTC[A/G]
CATTCTTTTTCAGCACAAAAAAGTAACCTTGCACCTACCAAAGAACACAATTATGTTATTTTATATTAATTAGTTCTATAAAATAACATAAACATGTATA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.40%	11.90%	3.70%	0.00%	NA
All Indica	2759	73.90%	20.10%	5.98%	0.00%	NA
All Japonica	1512	99.60%	0.30%	0.13%	0.00%	NA
Aus	269	98.50%	0.40%	1.12%	0.00%	NA
Indica I	595	63.00%	21.80%	15.13%	0.00%	NA
Indica II	465	89.50%	8.40%	2.15%	0.00%	NA
Indica III	913	72.50%	25.50%	1.97%	0.00%	NA
Indica Intermediate	786	74.60%	19.50%	5.98%	0.00%	NA
Temperate Japonica	767	99.60%	0.10%	0.26%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	91.10%	4.40%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0142475082	T -> C	LOC_Os01g73270.1	downstream_gene_variant ; 3232.0bp to feature; MODIFIER	silent_mutation	Average:26.183; most accessible tissue: Callus, score: 38.875	N	N	N	N
vg0142475082	T -> C	LOC_Os01g73280.1	downstream_gene_variant ; 1012.0bp to feature; MODIFIER	silent_mutation	Average:26.183; most accessible tissue: Callus, score: 38.875	N	N	N	N
vg0142475082	T -> C	LOC_Os01g73300.1	downstream_gene_variant ; 4581.0bp to feature; MODIFIER	silent_mutation	Average:26.183; most accessible tissue: Callus, score: 38.875	N	N	N	N
vg0142475082	T -> C	LOC_Os01g73290.1	intron_variant ; MODIFIER	silent_mutation	Average:26.183; most accessible tissue: Callus, score: 38.875	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0142475082	3.13E-06	3.13E-06	mr1379	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142475082	NA	2.83E-06	mr1201_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142475082	NA	3.99E-06	mr1274_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251