\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142475082:

Variant ID: vg0142475082 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 42475082
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


TATACATGTTTATGTTATTTTATAGAACTAATTAATATAAAATAACATAATTGTGTTCTTTGGTAGGTGCAAGGTTACTTTTTTGTGCTGAAAAAGAATG[T/C]
GACAAAACTGTATACATAGATAGATGCAACATAATATAGCTCTAACTAATACAGGATATCGTAATTATGTTCTTTAGTAGGTGCAATGTTAGTTTCTTCT

Reverse complement sequence

AGAAGAAACTAACATTGCACCTACTAAAGAACATAATTACGATATCCTGTATTAGTTAGAGCTATATTATGTTGCATCTATCTATGTATACAGTTTTGTC[A/G]
CATTCTTTTTCAGCACAAAAAAGTAACCTTGCACCTACCAAAGAACACAATTATGTTATTTTATATTAATTAGTTCTATAAAATAACATAAACATGTATA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.40% 11.90% 3.70% 0.00% NA
All Indica  2759 73.90% 20.10% 5.98% 0.00% NA
All Japonica  1512 99.60% 0.30% 0.13% 0.00% NA
Aus  269 98.50% 0.40% 1.12% 0.00% NA
Indica I  595 63.00% 21.80% 15.13% 0.00% NA
Indica II  465 89.50% 8.40% 2.15% 0.00% NA
Indica III  913 72.50% 25.50% 1.97% 0.00% NA
Indica Intermediate  786 74.60% 19.50% 5.98% 0.00% NA
Temperate Japonica  767 99.60% 0.10% 0.26% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 91.10% 4.40% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142475082 T -> C LOC_Os01g73270.1 downstream_gene_variant ; 3232.0bp to feature; MODIFIER silent_mutation Average:26.183; most accessible tissue: Callus, score: 38.875 N N N N
vg0142475082 T -> C LOC_Os01g73280.1 downstream_gene_variant ; 1012.0bp to feature; MODIFIER silent_mutation Average:26.183; most accessible tissue: Callus, score: 38.875 N N N N
vg0142475082 T -> C LOC_Os01g73300.1 downstream_gene_variant ; 4581.0bp to feature; MODIFIER silent_mutation Average:26.183; most accessible tissue: Callus, score: 38.875 N N N N
vg0142475082 T -> C LOC_Os01g73290.1 intron_variant ; MODIFIER silent_mutation Average:26.183; most accessible tissue: Callus, score: 38.875 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142475082 3.13E-06 3.13E-06 mr1379 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142475082 NA 2.83E-06 mr1201_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142475082 NA 3.99E-06 mr1274_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251