Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142463852:

Variant ID: vg0142463852 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 42463852
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:

GTATACATGCGGAAAATGAGATTTTCTTTTCACCTTCTCACACTGTCAAACATAGATTAATGTTCTCATCGATTGTCCATATTTTCTAATAAACCAAAAC[G/A]
GCTTATTTAAAATAAAAATATGTATTGTTAGTGACTTAAAAACAAATAAGTAGAAACTACATTAAAAATACCTTTAAATCAACTTTAGAAGTAAGTTTAA

Reverse complement sequence

TTAAACTTACTTCTAAAGTTGATTTAAAGGTATTTTTAATGTAGTTTCTACTTATTTGTTTTTAAGTCACTAACAATACATATTTTTATTTTAAATAAGC[C/T]
GTTTTGGTTTATTAGAAAATATGGACAATCGATGAGAACATTAATCTATGTTTGACAGTGTGAGAAGGTGAAAAGAAAATCTCATTTTCCGCATGTATAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.50%	47.30%	0.51%	2.67%	NA
All Indica	2759	62.80%	36.00%	0.69%	0.51%	NA
All Japonica	1512	19.20%	73.50%	0.13%	7.08%	NA
Aus	269	79.20%	20.40%	0.37%	0.00%	NA
Indica I	595	89.10%	10.40%	0.50%	0.00%	NA
Indica II	465	31.00%	67.30%	1.08%	0.65%	NA
Indica III	913	59.40%	39.30%	0.22%	1.10%	NA
Indica Intermediate	786	65.60%	33.10%	1.15%	0.13%	NA
Temperate Japonica	767	33.00%	66.80%	0.13%	0.13%	NA
Tropical Japonica	504	2.80%	76.80%	0.20%	20.24%	NA
Japonica Intermediate	241	10.00%	88.40%	0.00%	1.66%	NA
VI/Aromatic	96	72.90%	26.00%	0.00%	1.04%	NA
Intermediate	90	38.90%	54.40%	2.22%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0142463852	G -> A	LOC_Os01g73260.1	upstream_gene_variant ; 3215.0bp to feature; MODIFIER	silent_mutation	Average:27.561; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0142463852	G -> A	LOC_Os01g73250.1	downstream_gene_variant ; 1518.0bp to feature; MODIFIER	silent_mutation	Average:27.561; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0142463852	G -> A	LOC_Os01g73250.2	downstream_gene_variant ; 2668.0bp to feature; MODIFIER	silent_mutation	Average:27.561; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0142463852	G -> A	LOC_Os01g73250-LOC_Os01g73260	intergenic_region ; MODIFIER	silent_mutation	Average:27.561; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0142463852	G -> DEL	N	N	silent_mutation	Average:27.561; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0142463852	NA	6.67E-06	mr1170	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142463852	NA	2.07E-07	mr1629	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142463852	2.88E-09	3.55E-12	mr1974	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142463852	2.91E-09	2.00E-15	mr1974	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142463852	NA	1.49E-07	mr1984	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142463852	NA	2.20E-07	mr1188_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142463852	NA	7.84E-09	mr1974_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251