\
| Variant ID: vg0142463852 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 42463852 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 89. )
GTATACATGCGGAAAATGAGATTTTCTTTTCACCTTCTCACACTGTCAAACATAGATTAATGTTCTCATCGATTGTCCATATTTTCTAATAAACCAAAAC[G/A]
GCTTATTTAAAATAAAAATATGTATTGTTAGTGACTTAAAAACAAATAAGTAGAAACTACATTAAAAATACCTTTAAATCAACTTTAGAAGTAAGTTTAA
TTAAACTTACTTCTAAAGTTGATTTAAAGGTATTTTTAATGTAGTTTCTACTTATTTGTTTTTAAGTCACTAACAATACATATTTTTATTTTAAATAAGC[C/T]
GTTTTGGTTTATTAGAAAATATGGACAATCGATGAGAACATTAATCTATGTTTGACAGTGTGAGAAGGTGAAAAGAAAATCTCATTTTCCGCATGTATAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.50% | 47.30% | 0.51% | 2.67% | NA |
| All Indica | 2759 | 62.80% | 36.00% | 0.69% | 0.51% | NA |
| All Japonica | 1512 | 19.20% | 73.50% | 0.13% | 7.08% | NA |
| Aus | 269 | 79.20% | 20.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 89.10% | 10.40% | 0.50% | 0.00% | NA |
| Indica II | 465 | 31.00% | 67.30% | 1.08% | 0.65% | NA |
| Indica III | 913 | 59.40% | 39.30% | 0.22% | 1.10% | NA |
| Indica Intermediate | 786 | 65.60% | 33.10% | 1.15% | 0.13% | NA |
| Temperate Japonica | 767 | 33.00% | 66.80% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 2.80% | 76.80% | 0.20% | 20.24% | NA |
| Japonica Intermediate | 241 | 10.00% | 88.40% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 72.90% | 26.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 38.90% | 54.40% | 2.22% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0142463852 | G -> A | LOC_Os01g73260.1 | upstream_gene_variant ; 3215.0bp to feature; MODIFIER | silent_mutation | Average:27.561; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0142463852 | G -> A | LOC_Os01g73250.1 | downstream_gene_variant ; 1518.0bp to feature; MODIFIER | silent_mutation | Average:27.561; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0142463852 | G -> A | LOC_Os01g73250.2 | downstream_gene_variant ; 2668.0bp to feature; MODIFIER | silent_mutation | Average:27.561; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0142463852 | G -> A | LOC_Os01g73250-LOC_Os01g73260 | intergenic_region ; MODIFIER | silent_mutation | Average:27.561; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0142463852 | G -> DEL | N | N | silent_mutation | Average:27.561; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0142463852 | NA | 6.67E-06 | mr1170 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142463852 | NA | 2.07E-07 | mr1629 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142463852 | 2.88E-09 | 3.55E-12 | mr1974 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142463852 | 2.91E-09 | 2.00E-15 | mr1974 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142463852 | NA | 1.49E-07 | mr1984 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142463852 | NA | 2.20E-07 | mr1188_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142463852 | NA | 7.84E-09 | mr1974_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |