\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142463852:

Variant ID: vg0142463852 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 42463852
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


GTATACATGCGGAAAATGAGATTTTCTTTTCACCTTCTCACACTGTCAAACATAGATTAATGTTCTCATCGATTGTCCATATTTTCTAATAAACCAAAAC[G/A]
GCTTATTTAAAATAAAAATATGTATTGTTAGTGACTTAAAAACAAATAAGTAGAAACTACATTAAAAATACCTTTAAATCAACTTTAGAAGTAAGTTTAA

Reverse complement sequence

TTAAACTTACTTCTAAAGTTGATTTAAAGGTATTTTTAATGTAGTTTCTACTTATTTGTTTTTAAGTCACTAACAATACATATTTTTATTTTAAATAAGC[C/T]
GTTTTGGTTTATTAGAAAATATGGACAATCGATGAGAACATTAATCTATGTTTGACAGTGTGAGAAGGTGAAAAGAAAATCTCATTTTCCGCATGTATAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.50% 47.30% 0.51% 2.67% NA
All Indica  2759 62.80% 36.00% 0.69% 0.51% NA
All Japonica  1512 19.20% 73.50% 0.13% 7.08% NA
Aus  269 79.20% 20.40% 0.37% 0.00% NA
Indica I  595 89.10% 10.40% 0.50% 0.00% NA
Indica II  465 31.00% 67.30% 1.08% 0.65% NA
Indica III  913 59.40% 39.30% 0.22% 1.10% NA
Indica Intermediate  786 65.60% 33.10% 1.15% 0.13% NA
Temperate Japonica  767 33.00% 66.80% 0.13% 0.13% NA
Tropical Japonica  504 2.80% 76.80% 0.20% 20.24% NA
Japonica Intermediate  241 10.00% 88.40% 0.00% 1.66% NA
VI/Aromatic  96 72.90% 26.00% 0.00% 1.04% NA
Intermediate  90 38.90% 54.40% 2.22% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142463852 G -> A LOC_Os01g73260.1 upstream_gene_variant ; 3215.0bp to feature; MODIFIER silent_mutation Average:27.561; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0142463852 G -> A LOC_Os01g73250.1 downstream_gene_variant ; 1518.0bp to feature; MODIFIER silent_mutation Average:27.561; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0142463852 G -> A LOC_Os01g73250.2 downstream_gene_variant ; 2668.0bp to feature; MODIFIER silent_mutation Average:27.561; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0142463852 G -> A LOC_Os01g73250-LOC_Os01g73260 intergenic_region ; MODIFIER silent_mutation Average:27.561; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0142463852 G -> DEL N N silent_mutation Average:27.561; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142463852 NA 6.67E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142463852 NA 2.07E-07 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142463852 2.88E-09 3.55E-12 mr1974 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142463852 2.91E-09 2.00E-15 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142463852 NA 1.49E-07 mr1984 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142463852 NA 2.20E-07 mr1188_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142463852 NA 7.84E-09 mr1974_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251