\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142434413:

Variant ID: vg0142434413 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 42434413
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.76, A: 0.25, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


TAGCTAGAGATCACGATCGATGTATGTGTGGTTGTTGATTGGTACTATTTGTTTGTGCGGATTGCAATTAGGTTCGAATTAGGCTCGGATTATCTCGTTC[A/G]
ATTCGGTCACGCATGCATACTCTAAGTAAAACAGTCACGGATCGATCGGGTACCATATATGCTTAACCATATACCAAATTAAATAAAGGAGAAATATAAT

Reverse complement sequence

ATTATATTTCTCCTTTATTTAATTTGGTATATGGTTAAGCATATATGGTACCCGATCGATCCGTGACTGTTTTACTTAGAGTATGCATGCGTGACCGAAT[T/C]
GAACGAGATAATCCGAGCCTAATTCGAACCTAATTGCAATCCGCACAAACAAATAGTACCAATCAACAACCACACATACATCGATCGTGATCTCTAGCTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.40% 25.20% 0.15% 0.28% NA
All Indica  2759 80.40% 19.10% 0.07% 0.43% NA
All Japonica  1512 62.20% 37.50% 0.26% 0.00% NA
Aus  269 81.00% 18.60% 0.37% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 34.40% 64.10% 0.00% 1.51% NA
Indica III  913 91.20% 8.80% 0.00% 0.00% NA
Indica Intermediate  786 80.20% 19.00% 0.25% 0.64% NA
Temperate Japonica  767 75.40% 24.10% 0.52% 0.00% NA
Tropical Japonica  504 48.00% 52.00% 0.00% 0.00% NA
Japonica Intermediate  241 50.20% 49.80% 0.00% 0.00% NA
VI/Aromatic  96 77.10% 22.90% 0.00% 0.00% NA
Intermediate  90 72.20% 26.70% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142434413 A -> G LOC_Os01g73180.1 upstream_gene_variant ; 243.0bp to feature; MODIFIER silent_mutation Average:55.943; most accessible tissue: Zhenshan97 young leaf, score: 77.422 N N N N
vg0142434413 A -> G LOC_Os01g73190.1 upstream_gene_variant ; 2176.0bp to feature; MODIFIER silent_mutation Average:55.943; most accessible tissue: Zhenshan97 young leaf, score: 77.422 N N N N
vg0142434413 A -> G LOC_Os01g73170.1 downstream_gene_variant ; 1795.0bp to feature; MODIFIER silent_mutation Average:55.943; most accessible tissue: Zhenshan97 young leaf, score: 77.422 N N N N
vg0142434413 A -> G LOC_Os01g73180-LOC_Os01g73190 intergenic_region ; MODIFIER silent_mutation Average:55.943; most accessible tissue: Zhenshan97 young leaf, score: 77.422 N N N N
vg0142434413 A -> DEL N N silent_mutation Average:55.943; most accessible tissue: Zhenshan97 young leaf, score: 77.422 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142434413 NA 1.96E-18 Grain_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0142434413 NA 2.81E-12 Grain_width Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0142434413 NA 1.92E-06 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142434413 NA 8.40E-06 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142434413 NA 9.45E-06 mr1269 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142434413 NA 9.40E-06 mr1479 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142434413 NA 3.80E-07 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142434413 NA 7.89E-07 mr1543 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142434413 NA 3.56E-06 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142434413 NA 8.93E-09 mr1919 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142434413 2.00E-06 2.18E-11 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142434413 2.85E-06 5.86E-13 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142434413 NA 2.48E-06 mr1984 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142434413 NA 1.56E-08 mr1188_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142434413 NA 8.55E-07 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142434413 NA 1.21E-07 mr1323_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142434413 NA 3.61E-08 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142434413 NA 1.40E-06 mr1332_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142434413 NA 1.75E-07 mr1336_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142434413 NA 8.32E-06 mr1438_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142434413 NA 9.17E-06 mr1527_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142434413 NA 1.28E-06 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142434413 NA 5.87E-08 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142434413 NA 1.48E-06 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142434413 NA 1.86E-06 mr1931_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142434413 NA 1.71E-06 mr1942_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142434413 2.84E-09 3.56E-10 mr1974_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142434413 2.92E-07 1.34E-10 mr1974_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251