\
| Variant ID: vg0142433667 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 42433667 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TTAATCAAAGTTAAAGCAGTTTAACTTTAACTAAAATCAAAATGTTTTATAACGGAGGTAGTAATCAATAATTAATCAGATCGCCGGCGTCTTGTCTGCT[G/C]
ATGGATCATACAGTATAATGGAATGACGGATGGTTCCTGTAGATGGAATGACGGATGAGGCTTGTGCAACAGCGGCATGCCAAGACGCACAAGACGAAGC
GCTTCGTCTTGTGCGTCTTGGCATGCCGCTGTTGCACAAGCCTCATCCGTCATTCCATCTACAGGAACCATCCGTCATTCCATTATACTGTATGATCCAT[C/G]
AGCAGACAAGACGCCGGCGATCTGATTAATTATTGATTACTACCTCCGTTATAAAACATTTTGATTTTAGTTAAAGTTAAACTGCTTTAACTTTGATTAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.00% | 8.80% | 0.23% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 74.60% | 24.70% | 0.73% | 0.00% | NA |
| Aus | 269 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 78.20% | 20.30% | 1.43% | 0.00% | NA |
| Tropical Japonica | 504 | 76.40% | 23.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 59.30% | 40.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 80.20% | 19.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0142433667 | G -> C | LOC_Os01g73190.1 | upstream_gene_variant ; 2922.0bp to feature; MODIFIER | silent_mutation | Average:38.351; most accessible tissue: Zhenshan97 flower, score: 57.454 | N | N | N | N |
| vg0142433667 | G -> C | LOC_Os01g73170.1 | downstream_gene_variant ; 1049.0bp to feature; MODIFIER | silent_mutation | Average:38.351; most accessible tissue: Zhenshan97 flower, score: 57.454 | N | N | N | N |
| vg0142433667 | G -> C | LOC_Os01g73180.1 | downstream_gene_variant ; 234.0bp to feature; MODIFIER | silent_mutation | Average:38.351; most accessible tissue: Zhenshan97 flower, score: 57.454 | N | N | N | N |
| vg0142433667 | G -> C | LOC_Os01g73170-LOC_Os01g73180 | intergenic_region ; MODIFIER | silent_mutation | Average:38.351; most accessible tissue: Zhenshan97 flower, score: 57.454 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0142433667 | 7.85E-06 | NA | mr1074_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142433667 | 3.92E-06 | 3.92E-06 | mr1074_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142433667 | NA | 1.37E-07 | mr1215_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142433667 | NA | 1.13E-06 | mr1221_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142433667 | 2.90E-06 | NA | mr1301_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142433667 | NA | 2.95E-07 | mr1574_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142433667 | 4.37E-06 | NA | mr1993_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |