\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142433667:

Variant ID: vg0142433667 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 42433667
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTAATCAAAGTTAAAGCAGTTTAACTTTAACTAAAATCAAAATGTTTTATAACGGAGGTAGTAATCAATAATTAATCAGATCGCCGGCGTCTTGTCTGCT[G/C]
ATGGATCATACAGTATAATGGAATGACGGATGGTTCCTGTAGATGGAATGACGGATGAGGCTTGTGCAACAGCGGCATGCCAAGACGCACAAGACGAAGC

Reverse complement sequence

GCTTCGTCTTGTGCGTCTTGGCATGCCGCTGTTGCACAAGCCTCATCCGTCATTCCATCTACAGGAACCATCCGTCATTCCATTATACTGTATGATCCAT[C/G]
AGCAGACAAGACGCCGGCGATCTGATTAATTATTGATTACTACCTCCGTTATAAAACATTTTGATTTTAGTTAAAGTTAAACTGCTTTAACTTTGATTAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.00% 8.80% 0.23% 0.00% NA
All Indica  2759 99.70% 0.30% 0.00% 0.00% NA
All Japonica  1512 74.60% 24.70% 0.73% 0.00% NA
Aus  269 97.40% 2.60% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.60% 0.00% 0.00% NA
Temperate Japonica  767 78.20% 20.30% 1.43% 0.00% NA
Tropical Japonica  504 76.40% 23.60% 0.00% 0.00% NA
Japonica Intermediate  241 59.30% 40.70% 0.00% 0.00% NA
VI/Aromatic  96 80.20% 19.80% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142433667 G -> C LOC_Os01g73190.1 upstream_gene_variant ; 2922.0bp to feature; MODIFIER silent_mutation Average:38.351; most accessible tissue: Zhenshan97 flower, score: 57.454 N N N N
vg0142433667 G -> C LOC_Os01g73170.1 downstream_gene_variant ; 1049.0bp to feature; MODIFIER silent_mutation Average:38.351; most accessible tissue: Zhenshan97 flower, score: 57.454 N N N N
vg0142433667 G -> C LOC_Os01g73180.1 downstream_gene_variant ; 234.0bp to feature; MODIFIER silent_mutation Average:38.351; most accessible tissue: Zhenshan97 flower, score: 57.454 N N N N
vg0142433667 G -> C LOC_Os01g73170-LOC_Os01g73180 intergenic_region ; MODIFIER silent_mutation Average:38.351; most accessible tissue: Zhenshan97 flower, score: 57.454 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142433667 7.85E-06 NA mr1074_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142433667 3.92E-06 3.92E-06 mr1074_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142433667 NA 1.37E-07 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142433667 NA 1.13E-06 mr1221_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142433667 2.90E-06 NA mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142433667 NA 2.95E-07 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142433667 4.37E-06 NA mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251