\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142427760:

Variant ID: vg0142427760 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 42427760
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACGTGCTCAACATTTACAGCTTTCTTTTAGTGGTAGCCGATGTATACGTCGACAACGAAACATCCGTGCTGACTTCGTCAATCTTAAGATTTGCTAGTA[C/T]
AGTTTTTAGAGATGCTCATAGGGGTAAGGTGTGTGTGTGTATATTTATAGGGACGACCGTGCGCGTGTTGTGAACGTATGTTTGTCATATGCTTTTTTTT

Reverse complement sequence

AAAAAAAAGCATATGACAAACATACGTTCACAACACGCGCACGGTCGTCCCTATAAATATACACACACACACCTTACCCCTATGAGCATCTCTAAAAACT[G/A]
TACTAGCAAATCTTAAGATTGACGAAGTCAGCACGGATGTTTCGTTGTCGACGTATACATCGGCTACCACTAAAAGAAAGCTGTAAATGTTGAGCACGTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.10% 2.40% 2.05% 8.44% NA
All Indica  2759 92.50% 4.00% 3.15% 0.29% NA
All Japonica  1512 75.70% 0.10% 0.53% 23.68% NA
Aus  269 97.00% 0.00% 0.37% 2.60% NA
Indica I  595 78.20% 11.40% 10.42% 0.00% NA
Indica II  465 98.90% 0.40% 0.65% 0.00% NA
Indica III  913 98.50% 1.20% 0.00% 0.33% NA
Indica Intermediate  786 92.70% 3.80% 2.80% 0.64% NA
Temperate Japonica  767 80.60% 0.10% 0.26% 19.04% NA
Tropical Japonica  504 76.20% 0.00% 0.79% 23.02% NA
Japonica Intermediate  241 59.30% 0.00% 0.83% 39.83% NA
VI/Aromatic  96 81.20% 0.00% 0.00% 18.75% NA
Intermediate  90 88.90% 1.10% 1.11% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142427760 C -> T LOC_Os01g73150.1 upstream_gene_variant ; 2896.0bp to feature; MODIFIER silent_mutation Average:78.847; most accessible tissue: Callus, score: 94.304 N N N N
vg0142427760 C -> T LOC_Os01g73160.1 upstream_gene_variant ; 502.0bp to feature; MODIFIER silent_mutation Average:78.847; most accessible tissue: Callus, score: 94.304 N N N N
vg0142427760 C -> T LOC_Os01g73170.1 upstream_gene_variant ; 1742.0bp to feature; MODIFIER silent_mutation Average:78.847; most accessible tissue: Callus, score: 94.304 N N N N
vg0142427760 C -> T LOC_Os01g73160-LOC_Os01g73170 intergenic_region ; MODIFIER silent_mutation Average:78.847; most accessible tissue: Callus, score: 94.304 N N N N
vg0142427760 C -> DEL N N silent_mutation Average:78.847; most accessible tissue: Callus, score: 94.304 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0142427760 C T -0.04 -0.03 -0.05 -0.01 -0.05 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142427760 NA 4.62E-06 mr1280 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142427760 NA 2.55E-06 mr1041_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142427760 NA 9.60E-07 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142427760 8.99E-06 7.31E-08 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142427760 2.38E-06 6.95E-08 mr1284_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142427760 4.34E-07 4.33E-07 mr1286_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142427760 NA 7.82E-07 mr1293_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142427760 1.23E-06 1.23E-06 mr1311_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142427760 6.19E-06 1.07E-08 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142427760 NA 1.95E-07 mr1373_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142427760 NA 6.14E-07 mr1374_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142427760 9.90E-07 1.06E-08 mr1397_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142427760 NA 3.31E-07 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142427760 NA 7.61E-06 mr1445_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142427760 4.07E-06 4.33E-09 mr1453_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142427760 NA 3.25E-07 mr1467_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142427760 NA 6.57E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142427760 NA 8.56E-06 mr1492_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142427760 NA 8.85E-06 mr1508_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142427760 NA 4.07E-08 mr1556_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142427760 7.17E-07 7.21E-07 mr1651_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142427760 5.47E-06 6.03E-08 mr1652_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142427760 NA 6.78E-07 mr1665_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142427760 8.99E-08 8.99E-08 mr1674_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142427760 1.43E-06 NA mr1682_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142427760 NA 1.74E-08 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142427760 NA 1.24E-06 mr1687_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142427760 2.17E-06 2.17E-06 mr1688_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142427760 NA 4.10E-06 mr1706_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142427760 NA 3.16E-07 mr1759_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142427760 NA 5.23E-06 mr1759_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142427760 NA 2.51E-07 mr1764_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142427760 NA 1.27E-07 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142427760 NA 1.33E-06 mr1811_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142427760 NA 7.61E-07 mr1812_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142427760 NA 1.73E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142427760 NA 7.50E-07 mr1833_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142427760 6.01E-06 6.01E-06 mr1847_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142427760 3.48E-06 3.47E-06 mr1979_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142427760 4.44E-07 4.44E-07 mr1983_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142427760 9.88E-06 9.87E-06 mr1983_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142427760 NA 9.56E-06 mr1984_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142427760 4.97E-06 4.97E-06 mr1984_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142427760 5.67E-06 5.67E-06 mr1985_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142427760 NA 5.34E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251