Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142417909:

Variant ID: vg0142417909 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 42417909
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGAAGACATGTCTTCCACGTTCAACGGCGACGAGTTCGCCCCGTTCTTGGGCTTCATCGGCGCCGCCCTCGCCCTCGTCTTCTCATGTAAGCATCCATCC[A/G]
CAAAAATACGAACACTAGCCAGCTCGATCAATCGATCGTAGCTGGCAATTGGCATTGCTAATTTTAGAGTTTTCTTAGGAGGGTGTAGTTGCTCTGTTCC

Reverse complement sequence

GGAACAGAGCAACTACACCCTCCTAAGAAAACTCTAAAATTAGCAATGCCAATTGCCAGCTACGATCGATTGATCGAGCTGGCTAGTGTTCGTATTTTTG[T/C]
GGATGGATGCTTACATGAGAAGACGAGGGCGAGGGCGGCGCCGATGAAGCCCAAGAACGGGGCGAACTCGTCGCCGTTGAACGTGGAAGACATGTCTTCT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.40%	0.10%	0.02%	8.51%	NA
All Indica	2759	99.70%	0.00%	0.00%	0.25%	NA
All Japonica	1512	75.80%	0.30%	0.07%	23.88%	NA
Aus	269	97.40%	0.00%	0.00%	2.60%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.70%	0.00%	0.00%	0.33%	NA
Indica Intermediate	786	99.40%	0.10%	0.00%	0.51%	NA
Temperate Japonica	767	80.70%	0.10%	0.00%	19.17%	NA
Tropical Japonica	504	76.20%	0.20%	0.20%	23.41%	NA
Japonica Intermediate	241	59.30%	0.80%	0.00%	39.83%	NA
VI/Aromatic	96	80.20%	0.00%	0.00%	19.79%	NA
Intermediate	90	91.10%	0.00%	0.00%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0142417909	A -> G	LOC_Os01g73120.1	upstream_gene_variant ; 1319.0bp to feature; MODIFIER	silent_mutation	Average:67.702; most accessible tissue: Zhenshan97 flower, score: 84.692	N	N	N	N
vg0142417909	A -> G	LOC_Os01g73110.1	downstream_gene_variant ; 4682.0bp to feature; MODIFIER	silent_mutation	Average:67.702; most accessible tissue: Zhenshan97 flower, score: 84.692	N	N	N	N
vg0142417909	A -> G	LOC_Os01g73140.1	downstream_gene_variant ; 1255.0bp to feature; MODIFIER	silent_mutation	Average:67.702; most accessible tissue: Zhenshan97 flower, score: 84.692	N	N	N	N
vg0142417909	A -> G	LOC_Os01g73150.1	downstream_gene_variant ; 3762.0bp to feature; MODIFIER	silent_mutation	Average:67.702; most accessible tissue: Zhenshan97 flower, score: 84.692	N	N	N	N
vg0142417909	A -> G	LOC_Os01g73130.1	intron_variant ; MODIFIER	silent_mutation	Average:67.702; most accessible tissue: Zhenshan97 flower, score: 84.692	N	N	N	N
vg0142417909	A -> DEL	N	N	silent_mutation	Average:67.702; most accessible tissue: Zhenshan97 flower, score: 84.692	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0142417909	A	G	-0.01	-0.02	-0.02	-0.01	-0.02	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0142417909	NA	6.57E-08	mr1215_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142417909	8.58E-06	NA	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142417909	NA	1.24E-06	mr1369_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142417909	NA	2.62E-07	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142417909	NA	2.40E-07	mr1453_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142417909	NA	1.44E-09	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142417909	NA	6.69E-06	mr1556_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142417909	4.33E-06	4.55E-08	mr1574_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142417909	NA	4.97E-06	mr1779_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142417909	NA	1.34E-07	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142417909	NA	6.06E-06	mr1992_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142417909	6.14E-06	NA	mr1993_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251