\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142417909:

Variant ID: vg0142417909 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 42417909
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGAAGACATGTCTTCCACGTTCAACGGCGACGAGTTCGCCCCGTTCTTGGGCTTCATCGGCGCCGCCCTCGCCCTCGTCTTCTCATGTAAGCATCCATCC[A/G]
CAAAAATACGAACACTAGCCAGCTCGATCAATCGATCGTAGCTGGCAATTGGCATTGCTAATTTTAGAGTTTTCTTAGGAGGGTGTAGTTGCTCTGTTCC

Reverse complement sequence

GGAACAGAGCAACTACACCCTCCTAAGAAAACTCTAAAATTAGCAATGCCAATTGCCAGCTACGATCGATTGATCGAGCTGGCTAGTGTTCGTATTTTTG[T/C]
GGATGGATGCTTACATGAGAAGACGAGGGCGAGGGCGGCGCCGATGAAGCCCAAGAACGGGGCGAACTCGTCGCCGTTGAACGTGGAAGACATGTCTTCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.40% 0.10% 0.02% 8.51% NA
All Indica  2759 99.70% 0.00% 0.00% 0.25% NA
All Japonica  1512 75.80% 0.30% 0.07% 23.88% NA
Aus  269 97.40% 0.00% 0.00% 2.60% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.70% 0.00% 0.00% 0.33% NA
Indica Intermediate  786 99.40% 0.10% 0.00% 0.51% NA
Temperate Japonica  767 80.70% 0.10% 0.00% 19.17% NA
Tropical Japonica  504 76.20% 0.20% 0.20% 23.41% NA
Japonica Intermediate  241 59.30% 0.80% 0.00% 39.83% NA
VI/Aromatic  96 80.20% 0.00% 0.00% 19.79% NA
Intermediate  90 91.10% 0.00% 0.00% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142417909 A -> G LOC_Os01g73120.1 upstream_gene_variant ; 1319.0bp to feature; MODIFIER silent_mutation Average:67.702; most accessible tissue: Zhenshan97 flower, score: 84.692 N N N N
vg0142417909 A -> G LOC_Os01g73110.1 downstream_gene_variant ; 4682.0bp to feature; MODIFIER silent_mutation Average:67.702; most accessible tissue: Zhenshan97 flower, score: 84.692 N N N N
vg0142417909 A -> G LOC_Os01g73140.1 downstream_gene_variant ; 1255.0bp to feature; MODIFIER silent_mutation Average:67.702; most accessible tissue: Zhenshan97 flower, score: 84.692 N N N N
vg0142417909 A -> G LOC_Os01g73150.1 downstream_gene_variant ; 3762.0bp to feature; MODIFIER silent_mutation Average:67.702; most accessible tissue: Zhenshan97 flower, score: 84.692 N N N N
vg0142417909 A -> G LOC_Os01g73130.1 intron_variant ; MODIFIER silent_mutation Average:67.702; most accessible tissue: Zhenshan97 flower, score: 84.692 N N N N
vg0142417909 A -> DEL N N silent_mutation Average:67.702; most accessible tissue: Zhenshan97 flower, score: 84.692 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0142417909 A G -0.01 -0.02 -0.02 -0.01 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142417909 NA 6.57E-08 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142417909 8.58E-06 NA mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142417909 NA 1.24E-06 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142417909 NA 2.62E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142417909 NA 2.40E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142417909 NA 1.44E-09 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142417909 NA 6.69E-06 mr1556_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142417909 4.33E-06 4.55E-08 mr1574_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142417909 NA 4.97E-06 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142417909 NA 1.34E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142417909 NA 6.06E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142417909 6.14E-06 NA mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251