\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142404932:

Variant ID: vg0142404932 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 42404932
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:


TCACCGGCGCCGCCATCTCCATAGCCCTCCCCACGCCGCCGTGCCGCCCGCCTCACCTCACCGCTGAGCCGCCCTCCCCATGCCCCGCCTTGCTCCCCTC[T/C]
GCCCTACTCCTCCCCCAAACCGCATCTTCTCCCCGACTCTCCCAAGCTCCCAACAACTGCATCGGCACTTCGTCACCGCGCGCCGCTGGTTTCTCCGCCG

Reverse complement sequence

CGGCGGAGAAACCAGCGGCGCGCGGTGACGAAGTGCCGATGCAGTTGTTGGGAGCTTGGGAGAGTCGGGGAGAAGATGCGGTTTGGGGGAGGAGTAGGGC[A/G]
GAGGGGAGCAAGGCGGGGCATGGGGAGGGCGGCTCAGCGGTGAGGTGAGGCGGGCGGCACGGCGGCGTGGGGAGGGCTATGGAGATGGCGGCGCCGGTGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.10% 13.40% 3.98% 11.53% NA
All Indica  2759 95.80% 2.10% 1.30% 0.83% NA
All Japonica  1512 21.80% 36.70% 9.39% 32.14% NA
Aus  269 95.90% 0.70% 1.12% 2.23% NA
Indica I  595 89.70% 5.90% 4.37% 0.00% NA
Indica II  465 97.60% 1.50% 0.43% 0.43% NA
Indica III  913 98.00% 0.20% 0.11% 1.64% NA
Indica Intermediate  786 96.60% 1.80% 0.89% 0.76% NA
Temperate Japonica  767 8.20% 68.30% 5.22% 18.25% NA
Tropical Japonica  504 34.30% 0.60% 16.87% 48.21% NA
Japonica Intermediate  241 38.60% 11.60% 7.05% 42.74% NA
VI/Aromatic  96 77.10% 3.10% 1.04% 18.75% NA
Intermediate  90 63.30% 16.70% 6.67% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142404932 T -> DEL N N silent_mutation Average:86.246; most accessible tissue: Zhenshan97 young leaf, score: 92.294 N N N N
vg0142404932 T -> C LOC_Os01g73080.1 upstream_gene_variant ; 3717.0bp to feature; MODIFIER silent_mutation Average:86.246; most accessible tissue: Zhenshan97 young leaf, score: 92.294 N N N N
vg0142404932 T -> C LOC_Os01g73080.2 upstream_gene_variant ; 3717.0bp to feature; MODIFIER silent_mutation Average:86.246; most accessible tissue: Zhenshan97 young leaf, score: 92.294 N N N N
vg0142404932 T -> C LOC_Os01g73080.3 upstream_gene_variant ; 3737.0bp to feature; MODIFIER silent_mutation Average:86.246; most accessible tissue: Zhenshan97 young leaf, score: 92.294 N N N N
vg0142404932 T -> C LOC_Os01g73090.1 downstream_gene_variant ; 2630.0bp to feature; MODIFIER silent_mutation Average:86.246; most accessible tissue: Zhenshan97 young leaf, score: 92.294 N N N N
vg0142404932 T -> C LOC_Os01g73100.1 intron_variant ; MODIFIER silent_mutation Average:86.246; most accessible tissue: Zhenshan97 young leaf, score: 92.294 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0142404932 T C -0.02 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142404932 NA 1.22E-11 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0142404932 NA 2.10E-16 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0142404932 2.43E-06 1.52E-21 Spikelet_length All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0142404932 NA 3.29E-16 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0142404932 NA 1.10E-08 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142404932 NA 4.84E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142404932 NA 3.09E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142404932 NA 1.46E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142404932 NA 2.11E-06 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142404932 NA 6.87E-10 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142404932 NA 4.44E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142404932 NA 2.34E-07 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142404932 NA 6.75E-06 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142404932 NA 4.90E-26 mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142404932 NA 4.08E-09 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142404932 NA 4.56E-08 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142404932 NA 4.11E-07 mr1715 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142404932 NA 6.20E-06 mr1937 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142404932 NA 2.57E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142404932 NA 7.33E-06 mr1977 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142404932 NA 1.30E-07 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142404932 NA 3.00E-06 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142404932 NA 1.56E-07 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142404932 NA 2.62E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142404932 NA 5.71E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142404932 NA 2.80E-08 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142404932 NA 8.40E-08 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142404932 NA 1.67E-09 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142404932 NA 8.61E-07 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142404932 NA 6.25E-11 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142404932 NA 3.44E-08 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142404932 NA 1.13E-08 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142404932 NA 1.75E-10 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142404932 NA 9.46E-06 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142404932 NA 5.56E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142404932 NA 4.39E-06 mr1715_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142404932 NA 1.45E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142404932 NA 7.92E-09 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142404932 NA 3.36E-10 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142404932 NA 4.86E-08 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142404932 NA 1.80E-08 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251