\
| Variant ID: vg0142373682 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 42373682 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ACATTCAATGAAACTAATTTCATGCTAAGTTTGTCTGTGAACATGGTTAACTATATTTAAAAAAAACTGGCTTAGAAAAAAAACAATGCATCTATAATAT[C/A]
AAACGGAGGTTATAAAATCCCATCCTTCTATATATATAATCCTTCATATATATCCTGATCTTGCCGAGATGGCTAGCTGATATATTATGACTAATTAAGT
ACTTAATTAGTCATAATATATCAGCTAGCCATCTCGGCAAGATCAGGATATATATGAAGGATTATATATATAGAAGGATGGGATTTTATAACCTCCGTTT[G/T]
ATATTATAGATGCATTGTTTTTTTTCTAAGCCAGTTTTTTTTAAATATAGTTAACCATGTTCACAGACAAACTTAGCATGAAATTAGTTTCATTGAATGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.90% | 8.60% | 0.44% | 15.04% | NA |
| All Indica | 2759 | 79.90% | 0.30% | 0.62% | 19.14% | NA |
| All Japonica | 1512 | 68.10% | 24.00% | 0.00% | 7.94% | NA |
| Aus | 269 | 78.80% | 2.60% | 0.74% | 17.84% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 31.40% | 0.00% | 1.51% | 67.10% | NA |
| Indica III | 913 | 88.80% | 0.30% | 0.44% | 10.41% | NA |
| Indica Intermediate | 786 | 83.10% | 0.80% | 0.76% | 15.39% | NA |
| Temperate Japonica | 767 | 80.70% | 18.90% | 0.00% | 0.39% | NA |
| Tropical Japonica | 504 | 54.20% | 23.60% | 0.00% | 22.22% | NA |
| Japonica Intermediate | 241 | 56.80% | 41.10% | 0.00% | 2.07% | NA |
| VI/Aromatic | 96 | 77.10% | 19.80% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 75.60% | 8.90% | 2.22% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0142373682 | C -> A | LOC_Os01g73040.1 | upstream_gene_variant ; 3512.0bp to feature; MODIFIER | silent_mutation | Average:36.523; most accessible tissue: Callus, score: 80.51 | N | N | N | N |
| vg0142373682 | C -> A | LOC_Os01g73024.1 | downstream_gene_variant ; 3317.0bp to feature; MODIFIER | silent_mutation | Average:36.523; most accessible tissue: Callus, score: 80.51 | N | N | N | N |
| vg0142373682 | C -> A | LOC_Os01g73024-LOC_Os01g73040 | intergenic_region ; MODIFIER | silent_mutation | Average:36.523; most accessible tissue: Callus, score: 80.51 | N | N | N | N |
| vg0142373682 | C -> DEL | N | N | silent_mutation | Average:36.523; most accessible tissue: Callus, score: 80.51 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0142373682 | NA | 4.80E-16 | Grain_length | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0142373682 | NA | 5.70E-12 | Grain_width | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0142373682 | NA | 6.12E-07 | mr1502 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142373682 | NA | 2.84E-06 | mr1543 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142373682 | NA | 5.80E-06 | mr1629 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142373682 | NA | 9.74E-07 | mr1919 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142373682 | NA | 3.77E-08 | mr1919 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142373682 | NA | 8.75E-07 | mr1928 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142373682 | NA | 2.08E-07 | mr1931 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142373682 | NA | 4.77E-06 | mr1942 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142373682 | 2.94E-06 | 2.27E-12 | mr1974 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142373682 | 1.65E-06 | 2.04E-13 | mr1974 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142373682 | NA | 2.74E-06 | mr1984 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142373682 | NA | 2.68E-08 | mr1188_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142373682 | NA | 8.44E-06 | mr1319_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142373682 | NA | 1.10E-07 | mr1322_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142373682 | NA | 8.83E-08 | mr1323_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142373682 | NA | 1.19E-09 | mr1330_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142373682 | NA | 1.20E-06 | mr1332_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142373682 | NA | 1.50E-07 | mr1336_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142373682 | NA | 4.99E-06 | mr1438_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142373682 | NA | 7.26E-06 | mr1527_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142373682 | NA | 9.49E-07 | mr1540_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142373682 | NA | 7.63E-08 | mr1557_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142373682 | NA | 5.23E-06 | mr1579_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142373682 | NA | 1.01E-06 | mr1732_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142373682 | NA | 3.24E-10 | mr1928_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142373682 | NA | 4.04E-07 | mr1928_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142373682 | NA | 1.10E-09 | mr1931_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142373682 | NA | 1.07E-06 | mr1931_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142373682 | NA | 1.11E-06 | mr1942_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142373682 | 3.15E-06 | 8.50E-09 | mr1974_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142373682 | 1.01E-06 | 2.89E-10 | mr1974_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |