Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142373131:

Variant ID: vg0142373131 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 42373131
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGCAGGGGATCGCCGCCGAGCCGCTGTCGCCGAGACGCCGCCGGGGAGAGCGCTAGATCGGGATCGGGATCGGTAGTGGTAGGGTTAGGGTTAGAAATTT[T/C]
ATTTTTTTTCTTTGACAGTAAAAACTAGGTATATTTTGCACTGAGGGCAAAATAGTCATTATTAAAAAAATAACGGTTGTAACGGTGTGGAGTTGACAGT

Reverse complement sequence

ACTGTCAACTCCACACCGTTACAACCGTTATTTTTTTAATAATGACTATTTTGCCCTCAGTGCAAAATATACCTAGTTTTTACTGTCAAAGAAAAAAAAT[A/G]
AAATTTCTAACCCTAACCCTACCACTACCGATCCCGATCCCGATCTAGCGCTCTCCCCGGCGGCGTCTCGGCGACAGCGGCTCGGCGGCGATCCCCTGCT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.50%	12.60%	1.38%	15.51%	NA
All Indica	2759	77.20%	0.80%	2.28%	19.72%	NA
All Japonica	1512	56.50%	35.30%	0.13%	8.07%	NA
Aus	269	78.40%	2.60%	0.00%	18.96%	NA
Indica I	595	95.00%	0.30%	4.71%	0.00%	NA
Indica II	465	30.30%	0.40%	1.29%	67.96%	NA
Indica III	913	86.90%	0.80%	1.31%	11.06%	NA
Indica Intermediate	786	80.30%	1.40%	2.16%	16.16%	NA
Temperate Japonica	767	78.00%	21.60%	0.00%	0.39%	NA
Tropical Japonica	504	27.60%	49.60%	0.20%	22.62%	NA
Japonica Intermediate	241	48.50%	49.00%	0.41%	2.07%	NA
VI/Aromatic	96	76.00%	20.80%	0.00%	3.12%	NA
Intermediate	90	72.20%	13.30%	0.00%	14.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0142373131	T -> DEL	N	N	silent_mutation	Average:46.855; most accessible tissue: Zhenshan97 panicle, score: 88.35	N	N	N	N
vg0142373131	T -> C	LOC_Os01g73040.1	upstream_gene_variant ; 4063.0bp to feature; MODIFIER	silent_mutation	Average:46.855; most accessible tissue: Zhenshan97 panicle, score: 88.35	N	N	N	N
vg0142373131	T -> C	LOC_Os01g73024.1	downstream_gene_variant ; 2766.0bp to feature; MODIFIER	silent_mutation	Average:46.855; most accessible tissue: Zhenshan97 panicle, score: 88.35	N	N	N	N
vg0142373131	T -> C	LOC_Os01g73024-LOC_Os01g73040	intergenic_region ; MODIFIER	silent_mutation	Average:46.855; most accessible tissue: Zhenshan97 panicle, score: 88.35	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0142373131	NA	3.17E-14	Grain_length	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0142373131	NA	6.84E-11	Grain_width	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0142373131	NA	1.32E-07	mr1193	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131	4.65E-06	4.64E-06	mr1193	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131	NA	3.22E-06	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131	NA	9.15E-06	mr1596	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131	NA	6.18E-06	mr1667	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131	NA	4.98E-10	mr1769	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131	NA	9.36E-06	mr1857	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131	NA	1.11E-06	mr1919	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131	4.92E-06	4.35E-11	mr1974	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131	NA	4.85E-11	mr1974	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131	NA	3.43E-08	mr1188_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131	4.57E-06	NA	mr1193_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131	NA	2.01E-07	mr1322_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131	NA	1.03E-06	mr1323_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131	NA	1.91E-07	mr1330_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131	NA	3.19E-08	mr1336_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131	NA	9.00E-06	mr1438_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131	NA	4.27E-06	mr1540_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131	NA	6.09E-06	mr1579_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131	NA	2.36E-09	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131	NA	5.13E-07	mr1928_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131	NA	1.84E-07	mr1931_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131	NA	1.11E-06	mr1942_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131	2.09E-06	1.41E-07	mr1974_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131	NA	4.45E-09	mr1974_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251