\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142373131:

Variant ID: vg0142373131 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 42373131
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGCAGGGGATCGCCGCCGAGCCGCTGTCGCCGAGACGCCGCCGGGGAGAGCGCTAGATCGGGATCGGGATCGGTAGTGGTAGGGTTAGGGTTAGAAATTT[T/C]
ATTTTTTTTCTTTGACAGTAAAAACTAGGTATATTTTGCACTGAGGGCAAAATAGTCATTATTAAAAAAATAACGGTTGTAACGGTGTGGAGTTGACAGT

Reverse complement sequence

ACTGTCAACTCCACACCGTTACAACCGTTATTTTTTTAATAATGACTATTTTGCCCTCAGTGCAAAATATACCTAGTTTTTACTGTCAAAGAAAAAAAAT[A/G]
AAATTTCTAACCCTAACCCTACCACTACCGATCCCGATCCCGATCTAGCGCTCTCCCCGGCGGCGTCTCGGCGACAGCGGCTCGGCGGCGATCCCCTGCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.50% 12.60% 1.38% 15.51% NA
All Indica  2759 77.20% 0.80% 2.28% 19.72% NA
All Japonica  1512 56.50% 35.30% 0.13% 8.07% NA
Aus  269 78.40% 2.60% 0.00% 18.96% NA
Indica I  595 95.00% 0.30% 4.71% 0.00% NA
Indica II  465 30.30% 0.40% 1.29% 67.96% NA
Indica III  913 86.90% 0.80% 1.31% 11.06% NA
Indica Intermediate  786 80.30% 1.40% 2.16% 16.16% NA
Temperate Japonica  767 78.00% 21.60% 0.00% 0.39% NA
Tropical Japonica  504 27.60% 49.60% 0.20% 22.62% NA
Japonica Intermediate  241 48.50% 49.00% 0.41% 2.07% NA
VI/Aromatic  96 76.00% 20.80% 0.00% 3.12% NA
Intermediate  90 72.20% 13.30% 0.00% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142373131 T -> DEL N N silent_mutation Average:46.855; most accessible tissue: Zhenshan97 panicle, score: 88.35 N N N N
vg0142373131 T -> C LOC_Os01g73040.1 upstream_gene_variant ; 4063.0bp to feature; MODIFIER silent_mutation Average:46.855; most accessible tissue: Zhenshan97 panicle, score: 88.35 N N N N
vg0142373131 T -> C LOC_Os01g73024.1 downstream_gene_variant ; 2766.0bp to feature; MODIFIER silent_mutation Average:46.855; most accessible tissue: Zhenshan97 panicle, score: 88.35 N N N N
vg0142373131 T -> C LOC_Os01g73024-LOC_Os01g73040 intergenic_region ; MODIFIER silent_mutation Average:46.855; most accessible tissue: Zhenshan97 panicle, score: 88.35 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142373131 NA 3.17E-14 Grain_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0142373131 NA 6.84E-11 Grain_width Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0142373131 NA 1.32E-07 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131 4.65E-06 4.64E-06 mr1193 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131 NA 3.22E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131 NA 9.15E-06 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131 NA 6.18E-06 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131 NA 4.98E-10 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131 NA 9.36E-06 mr1857 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131 NA 1.11E-06 mr1919 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131 4.92E-06 4.35E-11 mr1974 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131 NA 4.85E-11 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131 NA 3.43E-08 mr1188_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131 4.57E-06 NA mr1193_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131 NA 2.01E-07 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131 NA 1.03E-06 mr1323_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131 NA 1.91E-07 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131 NA 3.19E-08 mr1336_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131 NA 9.00E-06 mr1438_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131 NA 4.27E-06 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131 NA 6.09E-06 mr1579_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131 NA 2.36E-09 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131 NA 5.13E-07 mr1928_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131 NA 1.84E-07 mr1931_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131 NA 1.11E-06 mr1942_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131 2.09E-06 1.41E-07 mr1974_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142373131 NA 4.45E-09 mr1974_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251