\
| Variant ID: vg0142322025 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 42322025 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.11, others allele: 0.00, population size: 101. )
TTTTAAATAAGGAGGATGGTCAAACGTTGGATATAAAAACTTATAATTGCATTTAAAGTGGTACAGATGAAGTACAATTTACAACTGATATAGTAGTACT[G/A]
CTTCCTCTGTTTCACAATGTAAGACTTTTTAGCATTGCTAATATTCATTTAGATGTTAATGAATCTAGATATATGTTTATGTCTAGATTTATTAATATTT
AAATATTAATAAATCTAGACATAAACATATATCTAGATTCATTAACATCTAAATGAATATTAGCAATGCTAAAAAGTCTTACATTGTGAAACAGAGGAAG[C/T]
AGTACTACTATATCAGTTGTAAATTGTACTTCATCTGTACCACTTTAAATGCAATTATAAGTTTTTATATCCAACGTTTGACCATCCTCCTTATTTAAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.10% | 14.50% | 0.51% | 9.90% | NA |
| All Indica | 2759 | 60.70% | 21.90% | 0.76% | 16.71% | NA |
| All Japonica | 1512 | 98.80% | 0.90% | 0.07% | 0.20% | NA |
| Aus | 269 | 79.20% | 20.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 69.70% | 1.30% | 0.67% | 28.24% | NA |
| Indica II | 465 | 24.70% | 70.30% | 0.65% | 4.30% | NA |
| Indica III | 913 | 71.10% | 12.80% | 0.88% | 15.22% | NA |
| Indica Intermediate | 786 | 63.00% | 19.20% | 0.76% | 17.05% | NA |
| Temperate Japonica | 767 | 99.60% | 0.30% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 97.60% | 2.20% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.40% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 11.10% | 1.11% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0142322025 | G -> A | LOC_Os01g72970.1 | upstream_gene_variant ; 3798.0bp to feature; MODIFIER | silent_mutation | Average:59.845; most accessible tissue: Minghui63 root, score: 84.198 | N | N | N | N |
| vg0142322025 | G -> A | LOC_Os01g72960.1 | downstream_gene_variant ; 4346.0bp to feature; MODIFIER | silent_mutation | Average:59.845; most accessible tissue: Minghui63 root, score: 84.198 | N | N | N | N |
| vg0142322025 | G -> A | LOC_Os01g72960-LOC_Os01g72970 | intergenic_region ; MODIFIER | silent_mutation | Average:59.845; most accessible tissue: Minghui63 root, score: 84.198 | N | N | N | N |
| vg0142322025 | G -> DEL | N | N | silent_mutation | Average:59.845; most accessible tissue: Minghui63 root, score: 84.198 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0142322025 | NA | 6.74E-11 | mr1322 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142322025 | NA | 6.97E-08 | mr1322 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142322025 | NA | 9.85E-10 | mr1322_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142322025 | NA | 9.61E-06 | mr1322_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142322025 | NA | 5.97E-06 | mr1336_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142322025 | NA | 9.79E-09 | mr1438_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142322025 | NA | 4.21E-08 | mr1438_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142322025 | NA | 3.67E-06 | mr1974_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |