Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0142322025:

Variant ID: vg0142322025 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 42322025
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.11, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTAAATAAGGAGGATGGTCAAACGTTGGATATAAAAACTTATAATTGCATTTAAAGTGGTACAGATGAAGTACAATTTACAACTGATATAGTAGTACT[G/A]
CTTCCTCTGTTTCACAATGTAAGACTTTTTAGCATTGCTAATATTCATTTAGATGTTAATGAATCTAGATATATGTTTATGTCTAGATTTATTAATATTT

Reverse complement sequence

AAATATTAATAAATCTAGACATAAACATATATCTAGATTCATTAACATCTAAATGAATATTAGCAATGCTAAAAAGTCTTACATTGTGAAACAGAGGAAG[C/T]
AGTACTACTATATCAGTTGTAAATTGTACTTCATCTGTACCACTTTAAATGCAATTATAAGTTTTTATATCCAACGTTTGACCATCCTCCTTATTTAAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.10%	14.50%	0.51%	9.90%	NA
All Indica	2759	60.70%	21.90%	0.76%	16.71%	NA
All Japonica	1512	98.80%	0.90%	0.07%	0.20%	NA
Aus	269	79.20%	20.40%	0.37%	0.00%	NA
Indica I	595	69.70%	1.30%	0.67%	28.24%	NA
Indica II	465	24.70%	70.30%	0.65%	4.30%	NA
Indica III	913	71.10%	12.80%	0.88%	15.22%	NA
Indica Intermediate	786	63.00%	19.20%	0.76%	17.05%	NA
Temperate Japonica	767	99.60%	0.30%	0.00%	0.13%	NA
Tropical Japonica	504	97.60%	2.20%	0.00%	0.20%	NA
Japonica Intermediate	241	98.80%	0.40%	0.41%	0.41%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	83.30%	11.10%	1.11%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0142322025	G -> A	LOC_Os01g72970.1	upstream_gene_variant ; 3798.0bp to feature; MODIFIER	silent_mutation	Average:59.845; most accessible tissue: Minghui63 root, score: 84.198	N	N	N	N
vg0142322025	G -> A	LOC_Os01g72960.1	downstream_gene_variant ; 4346.0bp to feature; MODIFIER	silent_mutation	Average:59.845; most accessible tissue: Minghui63 root, score: 84.198	N	N	N	N
vg0142322025	G -> A	LOC_Os01g72960-LOC_Os01g72970	intergenic_region ; MODIFIER	silent_mutation	Average:59.845; most accessible tissue: Minghui63 root, score: 84.198	N	N	N	N
vg0142322025	G -> DEL	N	N	silent_mutation	Average:59.845; most accessible tissue: Minghui63 root, score: 84.198	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0142322025	NA	6.74E-11	mr1322	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142322025	NA	6.97E-08	mr1322	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142322025	NA	9.85E-10	mr1322_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142322025	NA	9.61E-06	mr1322_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142322025	NA	5.97E-06	mr1336_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142322025	NA	9.79E-09	mr1438_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142322025	NA	4.21E-08	mr1438_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142322025	NA	3.67E-06	mr1974_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251