Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0142309123:

Variant ID: vg0142309123 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 42309123
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 318. )

Flanking Sequence (100 bp) in Reference Genome:

TATTAGGGCTAACTAATAGTGTAAATAAAGCAACCAGGGACGCTAAAAGGTAAATGATCCAAGCTGCCATATTCAACATGCTTCTTGAAAAATAGTGTTG[G/A]
TCATATAGCCTAACAGCCCATGAGATGACCAGGGAAGTAATCATTATATCCAAACATTATAAATTCACAATCAATCGAAACAACGTGAAAACAATAACGT

Reverse complement sequence

ACGTTATTGTTTTCACGTTGTTTCGATTGATTGTGAATTTATAATGTTTGGATATAATGATTACTTCCCTGGTCATCTCATGGGCTGTTAGGCTATATGA[C/T]
CAACACTATTTTTCAAGAAGCATGTTGAATATGGCAGCTTGGATCATTTACCTTTTAGCGTCCCTGGTTGCTTTATTTACACTATTAGTTAGCCCTAATA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.00%	4.70%	1.23%	0.00%	NA
All Indica	2759	90.20%	7.90%	1.96%	0.00%	NA
All Japonica	1512	99.70%	0.30%	0.07%	0.00%	NA
Aus	269	99.30%	0.40%	0.37%	0.00%	NA
Indica I	595	77.10%	16.10%	6.72%	0.00%	NA
Indica II	465	98.30%	1.50%	0.22%	0.00%	NA
Indica III	913	93.10%	6.80%	0.11%	0.00%	NA
Indica Intermediate	786	91.90%	6.60%	1.53%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.40%	0.41%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	96.70%	2.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0142309123	G -> A	LOC_Os01g72950.1	upstream_gene_variant ; 3026.0bp to feature; MODIFIER	silent_mutation	Average:51.347; most accessible tissue: Minghui63 flower, score: 66.294	N	N	N	N
vg0142309123	G -> A	LOC_Os01g72940.1	intron_variant ; MODIFIER	silent_mutation	Average:51.347; most accessible tissue: Minghui63 flower, score: 66.294	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0142309123	NA	6.59E-06	mr1070	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142309123	NA	9.98E-07	mr1180	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142309123	NA	8.95E-06	mr1327	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142309123	NA	1.50E-06	mr1336	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142309123	9.05E-06	3.23E-07	mr1480	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142309123	4.95E-06	6.53E-10	mr1692	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142309123	NA	5.81E-06	mr1336_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142309123	NA	5.94E-06	mr1579_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142309123	5.80E-06	5.79E-06	mr1983_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251