| Variant ID: vg0142309123 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 42309123 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 318. )
TATTAGGGCTAACTAATAGTGTAAATAAAGCAACCAGGGACGCTAAAAGGTAAATGATCCAAGCTGCCATATTCAACATGCTTCTTGAAAAATAGTGTTG[G/A]
TCATATAGCCTAACAGCCCATGAGATGACCAGGGAAGTAATCATTATATCCAAACATTATAAATTCACAATCAATCGAAACAACGTGAAAACAATAACGT
ACGTTATTGTTTTCACGTTGTTTCGATTGATTGTGAATTTATAATGTTTGGATATAATGATTACTTCCCTGGTCATCTCATGGGCTGTTAGGCTATATGA[C/T]
CAACACTATTTTTCAAGAAGCATGTTGAATATGGCAGCTTGGATCATTTACCTTTTAGCGTCCCTGGTTGCTTTATTTACACTATTAGTTAGCCCTAATA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.00% | 4.70% | 1.23% | 0.00% | NA |
| All Indica | 2759 | 90.20% | 7.90% | 1.96% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 77.10% | 16.10% | 6.72% | 0.00% | NA |
| Indica II | 465 | 98.30% | 1.50% | 0.22% | 0.00% | NA |
| Indica III | 913 | 93.10% | 6.80% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 91.90% | 6.60% | 1.53% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 2.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0142309123 | G -> A | LOC_Os01g72950.1 | upstream_gene_variant ; 3026.0bp to feature; MODIFIER | silent_mutation | Average:51.347; most accessible tissue: Minghui63 flower, score: 66.294 | N | N | N | N |
| vg0142309123 | G -> A | LOC_Os01g72940.1 | intron_variant ; MODIFIER | silent_mutation | Average:51.347; most accessible tissue: Minghui63 flower, score: 66.294 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0142309123 | NA | 6.59E-06 | mr1070 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142309123 | NA | 9.98E-07 | mr1180 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142309123 | NA | 8.95E-06 | mr1327 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142309123 | NA | 1.50E-06 | mr1336 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142309123 | 9.05E-06 | 3.23E-07 | mr1480 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142309123 | 4.95E-06 | 6.53E-10 | mr1692 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142309123 | NA | 5.81E-06 | mr1336_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142309123 | NA | 5.94E-06 | mr1579_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142309123 | 5.80E-06 | 5.79E-06 | mr1983_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |