\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142309123:

Variant ID: vg0142309123 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 42309123
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 318. )

Flanking Sequence (100 bp) in Reference Genome:


TATTAGGGCTAACTAATAGTGTAAATAAAGCAACCAGGGACGCTAAAAGGTAAATGATCCAAGCTGCCATATTCAACATGCTTCTTGAAAAATAGTGTTG[G/A]
TCATATAGCCTAACAGCCCATGAGATGACCAGGGAAGTAATCATTATATCCAAACATTATAAATTCACAATCAATCGAAACAACGTGAAAACAATAACGT

Reverse complement sequence

ACGTTATTGTTTTCACGTTGTTTCGATTGATTGTGAATTTATAATGTTTGGATATAATGATTACTTCCCTGGTCATCTCATGGGCTGTTAGGCTATATGA[C/T]
CAACACTATTTTTCAAGAAGCATGTTGAATATGGCAGCTTGGATCATTTACCTTTTAGCGTCCCTGGTTGCTTTATTTACACTATTAGTTAGCCCTAATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.00% 4.70% 1.23% 0.00% NA
All Indica  2759 90.20% 7.90% 1.96% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.07% 0.00% NA
Aus  269 99.30% 0.40% 0.37% 0.00% NA
Indica I  595 77.10% 16.10% 6.72% 0.00% NA
Indica II  465 98.30% 1.50% 0.22% 0.00% NA
Indica III  913 93.10% 6.80% 0.11% 0.00% NA
Indica Intermediate  786 91.90% 6.60% 1.53% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 96.70% 2.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142309123 G -> A LOC_Os01g72950.1 upstream_gene_variant ; 3026.0bp to feature; MODIFIER silent_mutation Average:51.347; most accessible tissue: Minghui63 flower, score: 66.294 N N N N
vg0142309123 G -> A LOC_Os01g72940.1 intron_variant ; MODIFIER silent_mutation Average:51.347; most accessible tissue: Minghui63 flower, score: 66.294 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142309123 NA 6.59E-06 mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142309123 NA 9.98E-07 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142309123 NA 8.95E-06 mr1327 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142309123 NA 1.50E-06 mr1336 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142309123 9.05E-06 3.23E-07 mr1480 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142309123 4.95E-06 6.53E-10 mr1692 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142309123 NA 5.81E-06 mr1336_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142309123 NA 5.94E-06 mr1579_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142309123 5.80E-06 5.79E-06 mr1983_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251