\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142257399:

Variant ID: vg0142257399 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 42257399
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.02, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


GCTTAGCAATATGTTTCAATGTCGATTCATCGTACTAGAATGTATCACATCTAACCAATATTCTTTATACTTAGGGACAGAGGGAGCAATAGCTTTTTAC[G/A]
TGGACGAGGATGACAGATTAAGTAACGGCTACAGGTCACTGGAAAGTTTTGATGGATTTTCAGTTAAGAATTTTTTTCGCCAGCACGTAAAATAATTGCC

Reverse complement sequence

GGCAATTATTTTACGTGCTGGCGAAAAAAATTCTTAACTGAAAATCCATCAAAACTTTCCAGTGACCTGTAGCCGTTACTTAATCTGTCATCCTCGTCCA[C/T]
GTAAAAAGCTATTGCTCCCTCTGTCCCTAAGTATAAAGAATATTGGTTAGATGTGATACATTCTAGTACGATGAATCGACATTGAAACATATTGCTAAGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.70% 17.00% 0.21% 0.13% NA
All Indica  2759 96.90% 2.90% 0.11% 0.11% NA
All Japonica  1512 54.80% 44.70% 0.33% 0.20% NA
Aus  269 88.50% 11.20% 0.37% 0.00% NA
Indica I  595 94.50% 5.20% 0.34% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 98.20% 1.60% 0.00% 0.11% NA
Indica Intermediate  786 96.20% 3.40% 0.13% 0.25% NA
Temperate Japonica  767 17.20% 81.90% 0.52% 0.39% NA
Tropical Japonica  504 98.40% 1.40% 0.20% 0.00% NA
Japonica Intermediate  241 83.00% 17.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 80.00% 18.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142257399 G -> A LOC_Os01g72850.1 upstream_gene_variant ; 209.0bp to feature; MODIFIER silent_mutation Average:67.631; most accessible tissue: Minghui63 panicle, score: 86.442 N N N N
vg0142257399 G -> A LOC_Os01g72860.1 upstream_gene_variant ; 2896.0bp to feature; MODIFIER silent_mutation Average:67.631; most accessible tissue: Minghui63 panicle, score: 86.442 N N N N
vg0142257399 G -> A LOC_Os01g72834.1 downstream_gene_variant ; 1996.0bp to feature; MODIFIER silent_mutation Average:67.631; most accessible tissue: Minghui63 panicle, score: 86.442 N N N N
vg0142257399 G -> A LOC_Os01g72850-LOC_Os01g72860 intergenic_region ; MODIFIER silent_mutation Average:67.631; most accessible tissue: Minghui63 panicle, score: 86.442 N N N N
vg0142257399 G -> DEL N N silent_mutation Average:67.631; most accessible tissue: Minghui63 panicle, score: 86.442 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142257399 NA 3.15E-07 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142257399 NA 7.44E-06 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142257399 NA 2.61E-08 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142257399 NA 9.63E-08 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142257399 NA 5.53E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142257399 NA 1.94E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142257399 NA 1.04E-06 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142257399 NA 1.33E-08 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142257399 6.46E-06 1.07E-31 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142257399 NA 6.94E-10 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142257399 NA 7.18E-06 mr1693_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142257399 3.78E-07 8.68E-18 mr1959_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142257399 NA 2.52E-08 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251