Variant ID: vg0142257399 (JBrowse) | Variation Type: SNP |
Chromosome: chr01 | Position: 42257399 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.02, others allele: 0.00, population size: 120. )
GCTTAGCAATATGTTTCAATGTCGATTCATCGTACTAGAATGTATCACATCTAACCAATATTCTTTATACTTAGGGACAGAGGGAGCAATAGCTTTTTAC[G/A]
TGGACGAGGATGACAGATTAAGTAACGGCTACAGGTCACTGGAAAGTTTTGATGGATTTTCAGTTAAGAATTTTTTTCGCCAGCACGTAAAATAATTGCC
GGCAATTATTTTACGTGCTGGCGAAAAAAATTCTTAACTGAAAATCCATCAAAACTTTCCAGTGACCTGTAGCCGTTACTTAATCTGTCATCCTCGTCCA[C/T]
GTAAAAAGCTATTGCTCCCTCTGTCCCTAAGTATAAAGAATATTGGTTAGATGTGATACATTCTAGTACGATGAATCGACATTGAAACATATTGCTAAGC
Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 82.70% | 17.00% | 0.21% | 0.13% | NA |
All Indica | 2759 | 96.90% | 2.90% | 0.11% | 0.11% | NA |
All Japonica | 1512 | 54.80% | 44.70% | 0.33% | 0.20% | NA |
Aus | 269 | 88.50% | 11.20% | 0.37% | 0.00% | NA |
Indica I | 595 | 94.50% | 5.20% | 0.34% | 0.00% | NA |
Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
Indica III | 913 | 98.20% | 1.60% | 0.00% | 0.11% | NA |
Indica Intermediate | 786 | 96.20% | 3.40% | 0.13% | 0.25% | NA |
Temperate Japonica | 767 | 17.20% | 81.90% | 0.52% | 0.39% | NA |
Tropical Japonica | 504 | 98.40% | 1.40% | 0.20% | 0.00% | NA |
Japonica Intermediate | 241 | 83.00% | 17.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 80.00% | 18.90% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0142257399 | G -> A | LOC_Os01g72850.1 | upstream_gene_variant ; 209.0bp to feature; MODIFIER | silent_mutation | Average:67.631; most accessible tissue: Minghui63 panicle, score: 86.442 | N | N | N | N |
vg0142257399 | G -> A | LOC_Os01g72860.1 | upstream_gene_variant ; 2896.0bp to feature; MODIFIER | silent_mutation | Average:67.631; most accessible tissue: Minghui63 panicle, score: 86.442 | N | N | N | N |
vg0142257399 | G -> A | LOC_Os01g72834.1 | downstream_gene_variant ; 1996.0bp to feature; MODIFIER | silent_mutation | Average:67.631; most accessible tissue: Minghui63 panicle, score: 86.442 | N | N | N | N |
vg0142257399 | G -> A | LOC_Os01g72850-LOC_Os01g72860 | intergenic_region ; MODIFIER | silent_mutation | Average:67.631; most accessible tissue: Minghui63 panicle, score: 86.442 | N | N | N | N |
vg0142257399 | G -> DEL | N | N | silent_mutation | Average:67.631; most accessible tissue: Minghui63 panicle, score: 86.442 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0142257399 | NA | 3.15E-07 | mr1031 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0142257399 | NA | 7.44E-06 | mr1300 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0142257399 | NA | 2.61E-08 | mr1310 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0142257399 | NA | 9.63E-08 | mr1926 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0142257399 | NA | 5.53E-06 | mr1942 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0142257399 | NA | 1.94E-06 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0142257399 | NA | 1.04E-06 | mr1013_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0142257399 | NA | 1.33E-08 | mr1031_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0142257399 | 6.46E-06 | 1.07E-31 | mr1310_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0142257399 | NA | 6.94E-10 | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/