\
| Variant ID: vg0142253896 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 42253896 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 113. )
CATTGTCTCGTTTTTCTCTATAGACTATTTCTAAGCTAGTAGATAGCTTTGCTCTCTCTCTTCATTTAATATCTTCCAAGTAGAAAAATATGCTAACATG[G/A]
ATCTCTTGTAGAGAGCTTATAGATAACCATTCTTGGTGACCTAATTAATCCTTCTGTTGGAATACATTAATCCTGATCTGGAACATCAACTGAATAATTG
CAATTATTCAGTTGATGTTCCAGATCAGGATTAATGTATTCCAACAGAAGGATTAATTAGGTCACCAAGAATGGTTATCTATAAGCTCTCTACAAGAGAT[C/T]
CATGTTAGCATATTTTTCTACTTGGAAGATATTAAATGAAGAGAGAGAGCAAAGCTATCTACTAGCTTAGAAATAGTCTATAGAGAAAAACGAGACAATG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.80% | 7.80% | 1.44% | 0.00% | NA |
| All Indica | 2759 | 84.30% | 13.20% | 2.43% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 71.30% | 22.40% | 6.39% | 0.00% | NA |
| Indica II | 465 | 87.50% | 12.30% | 0.22% | 0.00% | NA |
| Indica III | 913 | 98.10% | 1.50% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 76.30% | 20.50% | 3.18% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 1.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0142253896 | G -> A | LOC_Os01g72850.1 | downstream_gene_variant ; 1759.0bp to feature; MODIFIER | silent_mutation | Average:65.985; most accessible tissue: Zhenshan97 root, score: 81.772 | N | N | N | N |
| vg0142253896 | G -> A | LOC_Os01g72834.1 | intron_variant ; MODIFIER | silent_mutation | Average:65.985; most accessible tissue: Zhenshan97 root, score: 81.772 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0142253896 | NA | 7.42E-06 | mr1236 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142253896 | NA | 7.24E-06 | mr1236 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142253896 | NA | 1.38E-08 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142253896 | NA | 3.37E-08 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142253896 | NA | 3.44E-06 | mr1985 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142253896 | 1.27E-07 | 1.27E-07 | mr1985 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142253896 | NA | 6.30E-09 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142253896 | NA | 1.80E-08 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142253896 | NA | 4.75E-07 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142253896 | NA | 2.43E-07 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142253896 | NA | 8.31E-06 | mr1974_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |