\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142245153:

Variant ID: vg0142245153 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 42245153
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


GTTGGGTTTTCTACTCAAGAACAATGATTTTGCAGCATCTGATTTATGAACATGTCAGAGAAATTTCTACTCAAGATGTAATGCGCTTGCATAATGCTGC[C/T]
GTCACTATCATTAAAGTTCTCTAAGCTCTAAGTTATCTGCTAATTAAGAGAGTTTGAGATGAGATCAAGATAATACATGTGAATCAATTGACTTTTTTTA

Reverse complement sequence

TAAAAAAAGTCAATTGATTCACATGTATTATCTTGATCTCATCTCAAACTCTCTTAATTAGCAGATAACTTAGAGCTTAGAGAACTTTAATGATAGTGAC[G/A]
GCAGCATTATGCAAGCGCATTACATCTTGAGTAGAAATTTCTCTGACATGTTCATAAATCAGATGCTGCAAAATCATTGTTCTTGAGTAGAAAACCCAAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.10% 32.00% 0.49% 2.39% NA
All Indica  2759 87.60% 12.20% 0.14% 0.04% NA
All Japonica  1512 27.10% 64.50% 1.26% 7.21% NA
Aus  269 40.10% 59.90% 0.00% 0.00% NA
Indica I  595 91.60% 8.20% 0.17% 0.00% NA
Indica II  465 96.60% 3.20% 0.22% 0.00% NA
Indica III  913 82.90% 17.10% 0.00% 0.00% NA
Indica Intermediate  786 84.90% 14.80% 0.25% 0.13% NA
Temperate Japonica  767 12.10% 86.20% 1.17% 0.52% NA
Tropical Japonica  504 42.30% 47.80% 0.60% 9.33% NA
Japonica Intermediate  241 42.70% 30.30% 2.90% 24.07% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 55.60% 41.10% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142245153 C -> T LOC_Os01g72820.1 3_prime_UTR_variant ; 1061.0bp to feature; MODIFIER silent_mutation Average:78.949; most accessible tissue: Zhenshan97 root, score: 97.309 N N N N
vg0142245153 C -> T LOC_Os01g72820.3 3_prime_UTR_variant ; 339.0bp to feature; MODIFIER silent_mutation Average:78.949; most accessible tissue: Zhenshan97 root, score: 97.309 N N N N
vg0142245153 C -> T LOC_Os01g72820.4 3_prime_UTR_variant ; 1234.0bp to feature; MODIFIER silent_mutation Average:78.949; most accessible tissue: Zhenshan97 root, score: 97.309 N N N N
vg0142245153 C -> T LOC_Os01g72820.6 3_prime_UTR_variant ; 1376.0bp to feature; MODIFIER silent_mutation Average:78.949; most accessible tissue: Zhenshan97 root, score: 97.309 N N N N
vg0142245153 C -> T LOC_Os01g72820.2 3_prime_UTR_variant ; 1061.0bp to feature; MODIFIER silent_mutation Average:78.949; most accessible tissue: Zhenshan97 root, score: 97.309 N N N N
vg0142245153 C -> T LOC_Os01g72820.5 3_prime_UTR_variant ; 1376.0bp to feature; MODIFIER silent_mutation Average:78.949; most accessible tissue: Zhenshan97 root, score: 97.309 N N N N
vg0142245153 C -> T LOC_Os01g72834.1 upstream_gene_variant ; 2543.0bp to feature; MODIFIER silent_mutation Average:78.949; most accessible tissue: Zhenshan97 root, score: 97.309 N N N N
vg0142245153 C -> T LOC_Os01g72810.1 downstream_gene_variant ; 4586.0bp to feature; MODIFIER silent_mutation Average:78.949; most accessible tissue: Zhenshan97 root, score: 97.309 N N N N
vg0142245153 C -> DEL N N silent_mutation Average:78.949; most accessible tissue: Zhenshan97 root, score: 97.309 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0142245153 C T 0.04 0.05 0.02 -0.02 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142245153 2.26E-06 NA mr1509_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142245153 NA 1.27E-06 mr1509_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142245153 1.27E-06 NA mr1519_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142245153 NA 3.70E-06 mr1519_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142245153 NA 8.28E-06 mr1544_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142245153 NA 2.49E-06 mr1546_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142245153 3.12E-06 NA mr1676_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142245153 NA 1.81E-06 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142245153 NA 8.76E-06 mr1722_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251