Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142244187:

Variant ID: vg0142244187 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 42244187
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, T: 0.00, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:

ATCTGATCCAGACATCCTGCAGATGGTATGAGGCATGTTGTTGCAAACACTTGGAGACTAAAGGTCTTTAGCTGGAAGAATTTAAACAAATGCCAAGTTG[T/A]
TAGTACTCAACTCCAACAGCAGGATTGATCTGCATTTTGTGGCCAATAAGACACATCTTATGTTCTTAGCTAATTGTGGTCCATAAAGCAACGTCGGTTG

Reverse complement sequence

CAACCGACGTTGCTTTATGGACCACAATTAGCTAAGAACATAAGATGTGTCTTATTGGCCACAAAATGCAGATCAATCCTGCTGTTGGAGTTGAGTACTA[A/T]
CAACTTGGCATTTGTTTAAATTCTTCCAGCTAAAGACCTTTAGTCTCCAAGTGTTTGCAACAACATGCCTCATACCATCTGCAGGATGTCTGGATCAGAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.60%	19.50%	0.44%	2.45%	NA
All Indica	2759	97.10%	2.80%	0.11%	0.04%	NA
All Japonica	1512	46.10%	45.40%	1.12%	7.41%	NA
Aus	269	48.30%	51.30%	0.37%	0.00%	NA
Indica I	595	94.50%	5.20%	0.34%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	99.10%	0.90%	0.00%	0.00%	NA
Indica Intermediate	786	95.70%	4.10%	0.13%	0.13%	NA
Temperate Japonica	767	15.50%	83.10%	0.91%	0.52%	NA
Tropical Japonica	504	88.30%	1.40%	0.60%	9.72%	NA
Japonica Intermediate	241	55.20%	17.40%	2.90%	24.48%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	76.70%	20.00%	0.00%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0142244187	T -> A	LOC_Os01g72820.1	3_prime_UTR_variant ; 95.0bp to feature; MODIFIER	silent_mutation	Average:76.433; most accessible tissue: Minghui63 root, score: 91.181	N	N	N	N
vg0142244187	T -> A	LOC_Os01g72820.4	3_prime_UTR_variant ; 268.0bp to feature; MODIFIER	silent_mutation	Average:76.433; most accessible tissue: Minghui63 root, score: 91.181	N	N	N	N
vg0142244187	T -> A	LOC_Os01g72820.6	3_prime_UTR_variant ; 410.0bp to feature; MODIFIER	silent_mutation	Average:76.433; most accessible tissue: Minghui63 root, score: 91.181	N	N	N	N
vg0142244187	T -> A	LOC_Os01g72820.2	3_prime_UTR_variant ; 95.0bp to feature; MODIFIER	silent_mutation	Average:76.433; most accessible tissue: Minghui63 root, score: 91.181	N	N	N	N
vg0142244187	T -> A	LOC_Os01g72834.1	upstream_gene_variant ; 3509.0bp to feature; MODIFIER	silent_mutation	Average:76.433; most accessible tissue: Minghui63 root, score: 91.181	N	N	N	N
vg0142244187	T -> A	LOC_Os01g72810.1	downstream_gene_variant ; 3620.0bp to feature; MODIFIER	silent_mutation	Average:76.433; most accessible tissue: Minghui63 root, score: 91.181	N	N	N	N
vg0142244187	T -> A	LOC_Os01g72820.3	intron_variant ; MODIFIER	silent_mutation	Average:76.433; most accessible tissue: Minghui63 root, score: 91.181	N	N	N	N
vg0142244187	T -> A	LOC_Os01g72820.5	intron_variant ; MODIFIER	silent_mutation	Average:76.433; most accessible tissue: Minghui63 root, score: 91.181	N	N	N	N
vg0142244187	T -> DEL	N	N	silent_mutation	Average:76.433; most accessible tissue: Minghui63 root, score: 91.181	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0142244187	T	A	-0.14	-0.01	0.0	0.0	0.01	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0142244187	NA	4.51E-08	mr1031	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142244187	NA	6.61E-07	mr1056	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142244187	NA	6.53E-06	mr1295	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142244187	NA	1.93E-07	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142244187	NA	1.47E-08	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142244187	NA	2.61E-12	mr1540	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142244187	NA	2.62E-14	mr1732	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142244187	NA	6.49E-07	mr1013_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142244187	NA	1.32E-09	mr1031_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142244187	NA	4.30E-08	mr1189_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142244187	NA	1.39E-07	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142244187	1.75E-06	2.62E-07	mr1348_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142244187	NA	5.08E-06	mr1509_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142244187	NA	2.97E-17	mr1539_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142244187	NA	8.53E-17	mr1540_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142244187	NA	6.97E-09	mr1543_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142244187	NA	1.89E-16	mr1732_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142244187	NA	2.98E-06	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251