\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142242102:

Variant ID: vg0142242102 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 42242102
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


CTCGAGTACATCCTCATTGGTTAGATGGGAGAAATACCAAATTATTACTACTAGAATTTGTGAATAGGTGTTTGTTTATGAGGAGCTGGAAACTGCAGGC[G/A]
GCAAAAATGATGTATGCAACATGAAGCATGTGTGCAACTTTAATTCCAATAATCATATAAAGGAGTTTCCTCCCAAACGATTGTTGTTTCTGTAAAGAAT

Reverse complement sequence

ATTCTTTACAGAAACAACAATCGTTTGGGAGGAAACTCCTTTATATGATTATTGGAATTAAAGTTGCACACATGCTTCATGTTGCATACATCATTTTTGC[C/T]
GCCTGCAGTTTCCAGCTCCTCATAAACAAACACCTATTCACAAATTCTAGTAGTAATAATTTGGTATTTCTCCCATCTAACCAATGAGGATGTACTCGAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.80% 32.00% 0.13% 0.00% NA
All Indica  2759 87.60% 12.30% 0.07% 0.00% NA
All Japonica  1512 35.50% 64.30% 0.20% 0.00% NA
Aus  269 39.80% 59.90% 0.37% 0.00% NA
Indica I  595 91.80% 8.20% 0.00% 0.00% NA
Indica II  465 96.60% 3.40% 0.00% 0.00% NA
Indica III  913 82.90% 17.10% 0.00% 0.00% NA
Indica Intermediate  786 84.60% 15.10% 0.25% 0.00% NA
Temperate Japonica  767 13.60% 86.00% 0.39% 0.00% NA
Tropical Japonica  504 52.40% 47.60% 0.00% 0.00% NA
Japonica Intermediate  241 70.10% 29.90% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 58.90% 41.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142242102 G -> A LOC_Os01g72800.1 upstream_gene_variant ; 4644.0bp to feature; MODIFIER silent_mutation Average:62.417; most accessible tissue: Zhenshan97 root, score: 80.208 N N N N
vg0142242102 G -> A LOC_Os01g72810.1 downstream_gene_variant ; 1535.0bp to feature; MODIFIER silent_mutation Average:62.417; most accessible tissue: Zhenshan97 root, score: 80.208 N N N N
vg0142242102 G -> A LOC_Os01g72820.1 intron_variant ; MODIFIER silent_mutation Average:62.417; most accessible tissue: Zhenshan97 root, score: 80.208 N N N N
vg0142242102 G -> A LOC_Os01g72820.3 intron_variant ; MODIFIER silent_mutation Average:62.417; most accessible tissue: Zhenshan97 root, score: 80.208 N N N N
vg0142242102 G -> A LOC_Os01g72820.4 intron_variant ; MODIFIER silent_mutation Average:62.417; most accessible tissue: Zhenshan97 root, score: 80.208 N N N N
vg0142242102 G -> A LOC_Os01g72820.6 intron_variant ; MODIFIER silent_mutation Average:62.417; most accessible tissue: Zhenshan97 root, score: 80.208 N N N N
vg0142242102 G -> A LOC_Os01g72820.2 intron_variant ; MODIFIER silent_mutation Average:62.417; most accessible tissue: Zhenshan97 root, score: 80.208 N N N N
vg0142242102 G -> A LOC_Os01g72820.5 intron_variant ; MODIFIER silent_mutation Average:62.417; most accessible tissue: Zhenshan97 root, score: 80.208 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142242102 2.21E-06 NA mr1509_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142242102 NA 1.27E-06 mr1509_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142242102 NA 3.70E-06 mr1519_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142242102 NA 8.28E-06 mr1544_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142242102 NA 2.49E-06 mr1546_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142242102 NA 8.76E-06 mr1722_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251