\
| Variant ID: vg0142242102 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 42242102 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 286. )
CTCGAGTACATCCTCATTGGTTAGATGGGAGAAATACCAAATTATTACTACTAGAATTTGTGAATAGGTGTTTGTTTATGAGGAGCTGGAAACTGCAGGC[G/A]
GCAAAAATGATGTATGCAACATGAAGCATGTGTGCAACTTTAATTCCAATAATCATATAAAGGAGTTTCCTCCCAAACGATTGTTGTTTCTGTAAAGAAT
ATTCTTTACAGAAACAACAATCGTTTGGGAGGAAACTCCTTTATATGATTATTGGAATTAAAGTTGCACACATGCTTCATGTTGCATACATCATTTTTGC[C/T]
GCCTGCAGTTTCCAGCTCCTCATAAACAAACACCTATTCACAAATTCTAGTAGTAATAATTTGGTATTTCTCCCATCTAACCAATGAGGATGTACTCGAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.80% | 32.00% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 87.60% | 12.30% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 35.50% | 64.30% | 0.20% | 0.00% | NA |
| Aus | 269 | 39.80% | 59.90% | 0.37% | 0.00% | NA |
| Indica I | 595 | 91.80% | 8.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 82.90% | 17.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 84.60% | 15.10% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 13.60% | 86.00% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 52.40% | 47.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 70.10% | 29.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 41.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0142242102 | G -> A | LOC_Os01g72800.1 | upstream_gene_variant ; 4644.0bp to feature; MODIFIER | silent_mutation | Average:62.417; most accessible tissue: Zhenshan97 root, score: 80.208 | N | N | N | N |
| vg0142242102 | G -> A | LOC_Os01g72810.1 | downstream_gene_variant ; 1535.0bp to feature; MODIFIER | silent_mutation | Average:62.417; most accessible tissue: Zhenshan97 root, score: 80.208 | N | N | N | N |
| vg0142242102 | G -> A | LOC_Os01g72820.1 | intron_variant ; MODIFIER | silent_mutation | Average:62.417; most accessible tissue: Zhenshan97 root, score: 80.208 | N | N | N | N |
| vg0142242102 | G -> A | LOC_Os01g72820.3 | intron_variant ; MODIFIER | silent_mutation | Average:62.417; most accessible tissue: Zhenshan97 root, score: 80.208 | N | N | N | N |
| vg0142242102 | G -> A | LOC_Os01g72820.4 | intron_variant ; MODIFIER | silent_mutation | Average:62.417; most accessible tissue: Zhenshan97 root, score: 80.208 | N | N | N | N |
| vg0142242102 | G -> A | LOC_Os01g72820.6 | intron_variant ; MODIFIER | silent_mutation | Average:62.417; most accessible tissue: Zhenshan97 root, score: 80.208 | N | N | N | N |
| vg0142242102 | G -> A | LOC_Os01g72820.2 | intron_variant ; MODIFIER | silent_mutation | Average:62.417; most accessible tissue: Zhenshan97 root, score: 80.208 | N | N | N | N |
| vg0142242102 | G -> A | LOC_Os01g72820.5 | intron_variant ; MODIFIER | silent_mutation | Average:62.417; most accessible tissue: Zhenshan97 root, score: 80.208 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0142242102 | 2.21E-06 | NA | mr1509_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142242102 | NA | 1.27E-06 | mr1509_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142242102 | NA | 3.70E-06 | mr1519_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142242102 | NA | 8.28E-06 | mr1544_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142242102 | NA | 2.49E-06 | mr1546_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142242102 | NA | 8.76E-06 | mr1722_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |