\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142144554:

Variant ID: vg0142144554 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 42144554
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, G: 0.06, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


CCAAATATCTTAATTTTTCAACCGTTAAAGAAAACAAATTTTATTTAGAAAAAACCGGGCCTAAACATACAACGCACAACGCATGTAGCCTTGGCCACCA[A/G]
TTCTTGCACAAATCTTGGCGCACATAGTGTGCGGCAAAAAAAAAACGTGAAATACCTGAGAAAAAAATCACGCGTCAGATCACTAGCAAAAACGCAACTT

Reverse complement sequence

AAGTTGCGTTTTTGCTAGTGATCTGACGCGTGATTTTTTTCTCAGGTATTTCACGTTTTTTTTTTGCCGCACACTATGTGCGCCAAGATTTGTGCAAGAA[T/C]
TGGTGGCCAAGGCTACATGCGTTGTGCGTTGTATGTTTAGGCCCGGTTTTTTCTAAATAAAATTTGTTTTCTTTAACGGTTGAAAAATTAAGATATTTGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.50% 36.30% 0.44% 1.69% NA
All Indica  2759 38.30% 60.80% 0.54% 0.36% NA
All Japonica  1512 94.00% 1.10% 0.33% 4.56% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 51.10% 47.10% 1.34% 0.50% NA
Indica II  465 17.80% 81.70% 0.43% 0.00% NA
Indica III  913 34.20% 65.60% 0.11% 0.11% NA
Indica Intermediate  786 45.50% 53.20% 0.51% 0.76% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 84.10% 2.20% 0.79% 12.90% NA
Japonica Intermediate  241 96.70% 1.20% 0.41% 1.66% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 76.70% 21.10% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142144554 A -> G LOC_Os01g72630.1 downstream_gene_variant ; 1516.0bp to feature; MODIFIER silent_mutation Average:67.283; most accessible tissue: Callus, score: 87.413 N N N N
vg0142144554 A -> G LOC_Os01g72630-LOC_Os01g72650 intergenic_region ; MODIFIER silent_mutation Average:67.283; most accessible tissue: Callus, score: 87.413 N N N N
vg0142144554 A -> DEL N N silent_mutation Average:67.283; most accessible tissue: Callus, score: 87.413 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142144554 NA 4.14E-06 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142144554 NA 7.88E-06 mr1312 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142144554 NA 1.43E-07 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142144554 NA 7.88E-07 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142144554 NA 9.50E-10 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142144554 NA 4.68E-08 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142144554 NA 5.54E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142144554 NA 5.06E-07 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142144554 NA 4.67E-07 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142144554 5.26E-06 9.18E-09 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142144554 4.43E-06 2.32E-10 mr1974 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142144554 5.07E-06 5.07E-06 mr1985 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142144554 NA 1.05E-06 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142144554 NA 1.85E-06 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142144554 NA 1.88E-07 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142144554 NA 5.61E-06 mr1968_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142144554 8.11E-06 1.05E-09 mr1974_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142144554 5.25E-06 4.65E-09 mr1974_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251