Variant ID: vg0142100802 (JBrowse) | Variation Type: SNP |
Chromosome: chr01 | Position: 42100802 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 245. )
GGATTTGCCTTTTTTTTTTTGGACGGAGGGAGTACTAGATATAGGTGTGTGTGTATCCATTATATTTGTGGCTATCGACAACACATCATATCTGGTATCA[A/G]
TGATACAAGCGCTTGATCTATATTTCTAATAAACCTAAATACATGTGGACTTGCAAACAACATATATTTGAGCGGAAACACAGCAATTAGCTCTTTTAGG
CCTAAAAGAGCTAATTGCTGTGTTTCCGCTCAAATATATGTTGTTTGCAAGTCCACATGTATTTAGGTTTATTAGAAATATAGATCAAGCGCTTGTATCA[T/C]
TGATACCAGATATGATGTGTTGTCGATAGCCACAAATATAATGGATACACACACACCTATATCTAGTACTCCCTCCGTCCAAAAAAAAAAAGGCAAATCC
Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 96.00% | 4.00% | 0.02% | 0.00% | NA |
All Indica | 2759 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Aus | 269 | 56.90% | 42.80% | 0.37% | 0.00% | NA |
Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica III | 913 | 97.70% | 2.30% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 80.20% | 19.80% | 0.00% | 0.00% | NA |
Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0142100802 | A -> G | LOC_Os01g72570.1 | downstream_gene_variant ; 4912.0bp to feature; MODIFIER | silent_mutation | Average:48.027; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
vg0142100802 | A -> G | LOC_Os01g72570-LOC_Os01g72590 | intergenic_region ; MODIFIER | silent_mutation | Average:48.027; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0142100802 | 4.63E-07 | 6.59E-08 | mr1249 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0142100802 | NA | 1.15E-09 | mr1585 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0142100802 | 3.58E-07 | NA | mr1151_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0142100802 | NA | 4.99E-06 | mr1230_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0142100802 | 1.67E-09 | NA | mr1248_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0142100802 | 4.43E-06 | NA | mr1251_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0142100802 | 2.09E-07 | 2.40E-06 | mr1263_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0142100802 | 9.65E-06 | 3.67E-07 | mr1406_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0142100802 | 4.36E-06 | NA | mr1435_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0142100802 | 3.87E-06 | NA | mr1844_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |