\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142100802:

Variant ID: vg0142100802 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 42100802
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


GGATTTGCCTTTTTTTTTTTGGACGGAGGGAGTACTAGATATAGGTGTGTGTGTATCCATTATATTTGTGGCTATCGACAACACATCATATCTGGTATCA[A/G]
TGATACAAGCGCTTGATCTATATTTCTAATAAACCTAAATACATGTGGACTTGCAAACAACATATATTTGAGCGGAAACACAGCAATTAGCTCTTTTAGG

Reverse complement sequence

CCTAAAAGAGCTAATTGCTGTGTTTCCGCTCAAATATATGTTGTTTGCAAGTCCACATGTATTTAGGTTTATTAGAAATATAGATCAAGCGCTTGTATCA[T/C]
TGATACCAGATATGATGTGTTGTCGATAGCCACAAATATAATGGATACACACACACCTATATCTAGTACTCCCTCCGTCCAAAAAAAAAAAGGCAAATCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.00% 4.00% 0.02% 0.00% NA
All Indica  2759 98.30% 1.70% 0.00% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 56.90% 42.80% 0.37% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 97.70% 2.30% 0.00% 0.00% NA
Indica Intermediate  786 97.20% 2.80% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 80.20% 19.80% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142100802 A -> G LOC_Os01g72570.1 downstream_gene_variant ; 4912.0bp to feature; MODIFIER silent_mutation Average:48.027; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0142100802 A -> G LOC_Os01g72570-LOC_Os01g72590 intergenic_region ; MODIFIER silent_mutation Average:48.027; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142100802 4.63E-07 6.59E-08 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142100802 NA 1.15E-09 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142100802 3.58E-07 NA mr1151_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142100802 NA 4.99E-06 mr1230_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142100802 1.67E-09 NA mr1248_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142100802 4.43E-06 NA mr1251_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142100802 2.09E-07 2.40E-06 mr1263_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142100802 9.65E-06 3.67E-07 mr1406_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142100802 4.36E-06 NA mr1435_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142100802 3.87E-06 NA mr1844_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251