\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142061158:

Variant ID: vg0142061158 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 42061158
Reference Allele: AAlternative Allele: T,AAT,ATTT,AT,ATTTTT,ATT
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, A: 0.02, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


GAGTTCGATTTCTTATTTTTGTTACAACTTGTAGAAATTAAATTTAAAATTGCATGTCTGGGGTAACATATTGCATAAGTATCTATCTTATCAAAAAAAA[A/T,AAT,ATTT,AT,ATTTTT,ATT]
TTAACCATTTAACTAGTTGACATGTAATAAATAGTTGGATATTCACCTAGGTGACTTGCTAAAAGTATTTCGCCATCCGTTTTCAATTGCATGTGCTCTA

Reverse complement sequence

TAGAGCACATGCAATTGAAAACGGATGGCGAAATACTTTTAGCAAGTCACCTAGGTGAATATCCAACTATTTATTACATGTCAACTAGTTAAATGGTTAA[T/A,ATT,AAAT,AT,AAAAAT,AAT]
TTTTTTTTGATAAGATAGATACTTATGCAATATGTTACCCCAGACATGCAATTTTAAATTTAATTTCTACAAGTTGTAACAAAAATAAGAAATCGAACTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.40% 23.20% 0.53% 0.00% AAT: 2.18%; ATTT: 0.38%; AT: 0.32%; ATTTTT: 0.04%
All Indica  2759 94.60% 3.40% 0.36% 0.00% ATTT: 0.58%; AAT: 0.58%; AT: 0.43%
All Japonica  1512 35.10% 64.50% 0.26% 0.00% ATTT: 0.13%; AAT: 0.07%
Aus  269 69.10% 0.40% 2.97% 0.00% AAT: 26.39%; AT: 1.12%
Indica I  595 88.70% 7.70% 0.50% 0.00% ATTT: 2.35%; AAT: 0.67%
Indica II  465 97.00% 2.60% 0.22% 0.00% AAT: 0.22%
Indica III  913 97.80% 0.40% 0.11% 0.00% AT: 1.31%; AAT: 0.22%; ATTT: 0.11%
Indica Intermediate  786 93.90% 4.20% 0.64% 0.00% AAT: 1.15%; ATTT: 0.13%
Temperate Japonica  767 8.20% 91.10% 0.39% 0.00% ATTT: 0.26%
Tropical Japonica  504 80.60% 19.00% 0.20% 0.00% AAT: 0.20%
Japonica Intermediate  241 25.30% 74.70% 0.00% 0.00% NA
VI/Aromatic  96 86.50% 0.00% 0.00% 0.00% AAT: 13.54%
Intermediate  90 65.60% 26.70% 3.33% 0.00% AAT: 2.22%; ATTTTT: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142061158 A -> AT LOC_Os01g72510.1 upstream_gene_variant ; 575.0bp to feature; MODIFIER silent_mutation Average:35.471; most accessible tissue: Minghui63 root, score: 50.524 N N N N
vg0142061158 A -> AT LOC_Os01g72520.1 downstream_gene_variant ; 2022.0bp to feature; MODIFIER silent_mutation Average:35.471; most accessible tissue: Minghui63 root, score: 50.524 N N N N
vg0142061158 A -> AT LOC_Os01g72510-LOC_Os01g72520 intergenic_region ; MODIFIER silent_mutation Average:35.471; most accessible tissue: Minghui63 root, score: 50.524 N N N N
vg0142061158 A -> T LOC_Os01g72510.1 upstream_gene_variant ; 574.0bp to feature; MODIFIER silent_mutation Average:35.471; most accessible tissue: Minghui63 root, score: 50.524 N N N N
vg0142061158 A -> T LOC_Os01g72520.1 downstream_gene_variant ; 2023.0bp to feature; MODIFIER silent_mutation Average:35.471; most accessible tissue: Minghui63 root, score: 50.524 N N N N
vg0142061158 A -> T LOC_Os01g72510-LOC_Os01g72520 intergenic_region ; MODIFIER silent_mutation Average:35.471; most accessible tissue: Minghui63 root, score: 50.524 N N N N
vg0142061158 A -> AAT LOC_Os01g72510.1 upstream_gene_variant ; 575.0bp to feature; MODIFIER silent_mutation Average:35.471; most accessible tissue: Minghui63 root, score: 50.524 N N N N
vg0142061158 A -> AAT LOC_Os01g72520.1 downstream_gene_variant ; 2022.0bp to feature; MODIFIER silent_mutation Average:35.471; most accessible tissue: Minghui63 root, score: 50.524 N N N N
vg0142061158 A -> AAT LOC_Os01g72510-LOC_Os01g72520 intergenic_region ; MODIFIER silent_mutation Average:35.471; most accessible tissue: Minghui63 root, score: 50.524 N N N N
vg0142061158 A -> ATT LOC_Os01g72510.1 upstream_gene_variant ; 575.0bp to feature; MODIFIER N Average:35.471; most accessible tissue: Minghui63 root, score: 50.524 N N N N
vg0142061158 A -> ATT LOC_Os01g72520.1 downstream_gene_variant ; 2022.0bp to feature; MODIFIER N Average:35.471; most accessible tissue: Minghui63 root, score: 50.524 N N N N
vg0142061158 A -> ATT LOC_Os01g72510-LOC_Os01g72520 intergenic_region ; MODIFIER N Average:35.471; most accessible tissue: Minghui63 root, score: 50.524 N N N N
vg0142061158 A -> ATTTTT LOC_Os01g72510.1 upstream_gene_variant ; 575.0bp to feature; MODIFIER silent_mutation Average:35.471; most accessible tissue: Minghui63 root, score: 50.524 N N N N
vg0142061158 A -> ATTTTT LOC_Os01g72520.1 downstream_gene_variant ; 2022.0bp to feature; MODIFIER silent_mutation Average:35.471; most accessible tissue: Minghui63 root, score: 50.524 N N N N
vg0142061158 A -> ATTTTT LOC_Os01g72510-LOC_Os01g72520 intergenic_region ; MODIFIER silent_mutation Average:35.471; most accessible tissue: Minghui63 root, score: 50.524 N N N N
vg0142061158 A -> ATTT LOC_Os01g72510.1 upstream_gene_variant ; 575.0bp to feature; MODIFIER silent_mutation Average:35.471; most accessible tissue: Minghui63 root, score: 50.524 N N N N
vg0142061158 A -> ATTT LOC_Os01g72520.1 downstream_gene_variant ; 2022.0bp to feature; MODIFIER silent_mutation Average:35.471; most accessible tissue: Minghui63 root, score: 50.524 N N N N
vg0142061158 A -> ATTT LOC_Os01g72510-LOC_Os01g72520 intergenic_region ; MODIFIER silent_mutation Average:35.471; most accessible tissue: Minghui63 root, score: 50.524 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142061158 NA 1.31E-11 Grain_width Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0142061158 NA 9.88E-06 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 2.33E-06 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 7.31E-07 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 1.12E-06 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 2.73E-07 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 4.78E-06 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 1.03E-08 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 6.13E-06 mr1269 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 1.78E-07 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 9.07E-07 mr1291 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 1.14E-06 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 1.72E-08 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 9.56E-07 mr1439 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 1.02E-06 mr1479 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 1.16E-07 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 6.01E-07 mr1543 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 3.63E-09 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 1.94E-08 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 2.75E-11 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 3.04E-06 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 4.00E-07 mr1606 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 1.31E-08 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 4.10E-06 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 2.79E-08 mr1642 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 9.86E-07 mr1677 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 8.10E-06 mr1684 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 5.42E-08 mr1720 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 4.70E-09 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 4.42E-08 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 2.06E-08 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 1.90E-16 mr1942 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 1.14E-07 mr1942 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 7.74E-07 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 7.81E-09 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 2.09E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 5.67E-08 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 8.60E-06 mr1291_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 1.51E-06 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 9.79E-06 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 8.91E-09 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 1.28E-20 mr1540_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 4.14E-07 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 2.34E-06 mr1543_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 1.01E-08 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 1.69E-09 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 6.17E-13 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 1.02E-10 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 2.89E-19 mr1732_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 2.78E-07 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 9.23E-11 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 4.57E-08 mr1861_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 7.02E-08 mr1879_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 4.84E-06 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 7.71E-06 mr1928_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 1.14E-06 mr1928_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 3.14E-06 mr1931_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 6.82E-08 mr1931_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 1.84E-14 mr1942_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 5.43E-06 mr1942_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 4.15E-09 mr1946_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 6.54E-07 mr1946_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 4.15E-09 mr1948_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 6.54E-07 mr1948_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158 NA 5.67E-09 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251