\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142054143:

Variant ID: vg0142054143 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 42054143
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.83, T: 0.16, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


ATCATGTTTTAGAATCGGATGCTCTCGACTGAACACATAATACAGTAAGGAAATGGCTATACATACGACCAGTGTGTATAATCCTTATCCGACTAGTTCT[C/T]
TAGTTGTTACTTGCCTGGTACCACATGGACAGAAATTAGCTTGCATAGAGAAAAATCCCTTGTCCGACTAGTTCTCTAGTTGTTACTTGCCTGGTCCCAC

Reverse complement sequence

GTGGGACCAGGCAAGTAACAACTAGAGAACTAGTCGGACAAGGGATTTTTCTCTATGCAAGCTAATTTCTGTCCATGTGGTACCAGGCAAGTAACAACTA[G/A]
AGAACTAGTCGGATAAGGATTATACACACTGGTCGTATGTATAGCCATTTCCTTACTGTATTATGTGTTCAGTCGAGAGCATCCGATTCTAAAACATGAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.80% 29.10% 0.13% 0.00% NA
All Indica  2759 87.40% 12.50% 0.11% 0.00% NA
All Japonica  1512 33.90% 65.90% 0.20% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 83.70% 16.00% 0.34% 0.00% NA
Indica II  465 95.10% 4.90% 0.00% 0.00% NA
Indica III  913 86.30% 13.70% 0.00% 0.00% NA
Indica Intermediate  786 87.00% 12.80% 0.13% 0.00% NA
Temperate Japonica  767 13.20% 86.40% 0.39% 0.00% NA
Tropical Japonica  504 64.10% 35.90% 0.00% 0.00% NA
Japonica Intermediate  241 36.90% 63.10% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 65.60% 34.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142054143 C -> T LOC_Os01g72510.1 downstream_gene_variant ; 4793.0bp to feature; MODIFIER silent_mutation Average:88.011; most accessible tissue: Minghui63 panicle, score: 95.966 N N N N
vg0142054143 C -> T LOC_Os01g72500-LOC_Os01g72510 intergenic_region ; MODIFIER silent_mutation Average:88.011; most accessible tissue: Minghui63 panicle, score: 95.966 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0142054143 C T 0.01 -0.04 -0.03 -0.03 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142054143 NA 1.79E-07 mr1008 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142054143 NA 6.72E-07 mr1009 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142054143 NA 1.74E-06 mr1014 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142054143 3.86E-06 1.90E-06 mr1015 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142054143 NA 4.14E-08 mr1008_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142054143 NA 8.16E-06 mr1015_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142054143 NA 5.08E-06 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142054143 NA 2.04E-07 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251