Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142033067:

Variant ID: vg0142033067 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 42033067
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:

AGAACTTGAATCCAACTTCCCTTATTTTTTTTCTACAAATCAAGTTCCAAAATGGAAGAAGGGAACCTTGCCATGATTCAAACTTTTTTCTTCAAACTTC[C/T]
AACTTTTTTGTTTGGACACATGAATGAAGCATTAATTATAGATGAAAAAAACAATTGCACAGTTTGCATGTAAATCACAAGAAGAATCTTATAACAATGT

Reverse complement sequence

ACATTGTTATAAGATTCTTCTTGTGATTTACATGCAAACTGTGCAATTGTTTTTTTCATCTATAATTAATGCTTCATTCATGTGTCCAAACAAAAAAGTT[G/A]
GAAGTTTGAAGAAAAAAGTTTGAATCATGGCAAGGTTCCCTTCTTCCATTTTGGAACTTGATTTGTAGAAAAAAAATAAGGGAAGTTGGATTCAAGTTCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.20%	34.60%	0.13%	0.00%	NA
All Indica	2759	66.00%	33.80%	0.18%	0.00%	NA
All Japonica	1512	66.60%	33.30%	0.07%	0.00%	NA
Aus	269	68.00%	32.00%	0.00%	0.00%	NA
Indica I	595	51.60%	48.10%	0.34%	0.00%	NA
Indica II	465	89.70%	10.10%	0.22%	0.00%	NA
Indica III	913	64.50%	35.40%	0.11%	0.00%	NA
Indica Intermediate	786	64.80%	35.10%	0.13%	0.00%	NA
Temperate Japonica	767	81.10%	18.90%	0.00%	0.00%	NA
Tropical Japonica	504	51.20%	48.60%	0.20%	0.00%	NA
Japonica Intermediate	241	52.70%	47.30%	0.00%	0.00%	NA
VI/Aromatic	96	18.80%	81.20%	0.00%	0.00%	NA
Intermediate	90	58.90%	41.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0142033067	C -> T	LOC_Os01g72490.1	downstream_gene_variant ; 4100.0bp to feature; MODIFIER	silent_mutation	Average:53.901; most accessible tissue: Callus, score: 81.83	N	N	N	N
vg0142033067	C -> T	LOC_Os01g72490.2	downstream_gene_variant ; 4100.0bp to feature; MODIFIER	silent_mutation	Average:53.901; most accessible tissue: Callus, score: 81.83	N	N	N	N
vg0142033067	C -> T	LOC_Os01g72480-LOC_Os01g72490	intergenic_region ; MODIFIER	silent_mutation	Average:53.901; most accessible tissue: Callus, score: 81.83	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0142033067	NA	1.41E-14	Plant_height	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0142033067	NA	1.08E-08	mr1013	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142033067	NA	8.73E-07	mr1015	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142033067	NA	7.49E-07	mr1031	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142033067	NA	6.59E-07	mr1034	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142033067	NA	1.69E-06	mr1056	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142033067	NA	9.74E-07	mr1291	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142033067	NA	1.90E-08	mr1543	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142033067	NA	1.77E-06	mr1268_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142033067	NA	9.00E-06	mr1319_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142033067	NA	1.42E-10	mr1327_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142033067	NA	2.42E-11	mr1352_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142033067	NA	2.90E-07	mr1378_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142033067	NA	3.62E-06	mr1428_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142033067	NA	4.24E-06	mr1474_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142033067	NA	6.10E-09	mr1627_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142033067	NA	2.61E-06	mr1636_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142033067	NA	7.50E-06	mr1706_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251