Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0141996640:

Variant ID: vg0141996640 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 41996640
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACACGAGATTTAACGTGGAAAACCCTCCCAAAGTAGGAGAGAAAAAACCACGAGCGCCAGCCAGCAAAATATCTTCACTATATCTGGGGTGAGGTTATAA[C/T]
GCCGCACGGCGGCTTACAAGAGGTATATATATAGTGGAACCCTAAAAGGGATGACGAGCTGGCCTTTATTAAGTACAAATGAATTTGGATCACAACTCAA

Reverse complement sequence

TTGAGTTGTGATCCAAATTCATTTGTACTTAATAAAGGCCAGCTCGTCATCCCTTTTAGGGTTCCACTATATATATACCTCTTGTAAGCCGCCGTGCGGC[G/A]
TTATAACCTCACCCCAGATATAGTGAAGATATTTTGCTGGCTGGCGCTCGTGGTTTTTTCTCTCCTACTTTGGGAGGGTTTTCCACGTTAAATCTCGTGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.10%	16.00%	5.88%	4.99%	NA
All Indica	2759	82.50%	2.90%	7.50%	7.10%	NA
All Japonica	1512	49.70%	43.30%	4.50%	2.51%	NA
Aus	269	98.90%	0.40%	0.74%	0.00%	NA
Indica I	595	76.30%	1.20%	12.27%	10.25%	NA
Indica II	465	88.00%	1.50%	5.38%	5.16%	NA
Indica III	913	85.80%	4.10%	5.91%	4.27%	NA
Indica Intermediate	786	80.00%	3.80%	7.00%	9.16%	NA
Temperate Japonica	767	80.30%	17.60%	1.69%	0.39%	NA
Tropical Japonica	504	13.70%	73.20%	7.14%	5.95%	NA
Japonica Intermediate	241	27.80%	62.20%	7.88%	2.07%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	76.70%	21.10%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0141996640	C -> T	LOC_Os01g72400.1	upstream_gene_variant ; 195.0bp to feature; MODIFIER	silent_mutation	Average:59.027; most accessible tissue: Zhenshan97 flag leaf, score: 78.761	N	N	N	N
vg0141996640	C -> T	LOC_Os01g72410.1	upstream_gene_variant ; 811.0bp to feature; MODIFIER	silent_mutation	Average:59.027; most accessible tissue: Zhenshan97 flag leaf, score: 78.761	N	N	N	N
vg0141996640	C -> T	LOC_Os01g72420.1	downstream_gene_variant ; 2945.0bp to feature; MODIFIER	silent_mutation	Average:59.027; most accessible tissue: Zhenshan97 flag leaf, score: 78.761	N	N	N	N
vg0141996640	C -> T	LOC_Os01g72400-LOC_Os01g72410	intergenic_region ; MODIFIER	silent_mutation	Average:59.027; most accessible tissue: Zhenshan97 flag leaf, score: 78.761	N	N	N	N
vg0141996640	C -> DEL	N	N	silent_mutation	Average:59.027; most accessible tissue: Zhenshan97 flag leaf, score: 78.761	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0141996640	NA	6.41E-09	mr1047	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996640	NA	2.65E-06	mr1047	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996640	NA	4.92E-06	mr1063	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996640	NA	4.49E-07	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996640	NA	7.30E-07	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996640	NA	6.70E-15	mr1449	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996640	NA	8.34E-09	mr1449	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996640	NA	1.12E-09	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996640	NA	5.74E-08	mr1527	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996640	NA	2.12E-07	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996640	NA	8.36E-12	mr1871	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996640	NA	1.17E-26	mr1042_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996640	NA	2.79E-08	mr1042_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996640	NA	8.46E-06	mr1063_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996640	NA	9.47E-08	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996640	NA	4.50E-06	mr1161_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996640	NA	3.65E-08	mr1189_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996640	NA	1.50E-06	mr1269_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996640	NA	1.42E-09	mr1338_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996640	NA	2.84E-07	mr1338_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996640	NA	5.46E-10	mr1354_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996640	NA	5.99E-08	mr1363_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996640	NA	2.30E-08	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996640	NA	4.67E-06	mr1419_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996640	NA	1.12E-06	mr1420_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996640	NA	2.78E-08	mr1479_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996640	NA	9.19E-08	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996640	NA	7.45E-11	mr1502_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996640	NA	1.78E-08	mr1502_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996640	NA	2.60E-10	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996640	3.59E-06	1.36E-10	mr1543_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996640	NA	2.67E-10	mr1543_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996640	NA	8.60E-06	mr1544_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996640	NA	2.14E-12	mr1646_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996640	NA	5.12E-13	mr1680_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996640	5.58E-07	8.45E-19	mr1742_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996640	NA	5.80E-10	mr1742_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996640	NA	4.10E-27	mr1871_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996640	NA	1.60E-09	mr1871_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996640	NA	4.46E-06	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996640	NA	5.99E-07	mr1966_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251